Molecular Biology and Genetics

Molecular Biology

Barcode data: Satyrium esculi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGAAAATGACTTTTTTCTACAAACCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGAACATCTTTAAGAATTCTAATTCGAATAGAATTAGGAACACCAGGATCTTTAATTGGAGAT---GATCAAATTTATAATACCATCGTAACAGCTCATGCTTTTATCATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTGCCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCACCCTCACTAATATTATTAATTAGAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATAGAGGATCATCAGTTGATTTAGCCATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGCATTAATAATTTATCTTTTGATCAAATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATATTACTAACTGATCGAAATTTAAATACTTCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Satyrium esculi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Satyrium esculi

The False Ilex Hairstreak (Satyrium esculi) is a butterfly in the family Lycaenidae.

Distribution[edit]

The False Ilex Hairstreak lives throughout North Africa (Morocco to Tunisia) and the Iberian peninsula (with the exception of Galicia, where its foodplants are absent). It is also found on the Balearic Islands and in Southern France from the Pyrenees to the Cote d'Azur, extending into Liguria in Italy.[1]

Life cycle and foodplants[edit]

The larvae feed on sclerophyllous oaks of woodland and maquis : Holm Oak and Kermes Oak.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!