Overview

Brief Summary

Ecology

found attached to Tellina senegambiensis
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A limpet-like shell, up to 15 mm across and 5 mm high. Apex with small nipple-shaped beaks, often slightly coiled. Growth lines parallel to edge of aperture, sometimes, especially near the aperture, with small projections. Shell exterior white or yellow, interior pearly white. Flesh yellow with white markings. No operculum.Calyptraea chinensis is a protandrous hermaphrodite: animals with a shell width of up to 2 mm are male, larger specimens are female. Calyptraea chinensis may spread further northwards and increase in abundance as a result of seawater warming.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Absent from North Sea and east Channel basin
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 90 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 113
  Temperature range (°C): 7.556 - 13.949
  Nitrate (umol/L): 0.437 - 0.693
  Salinity (PPS): 18.292 - 38.154
  Oxygen (ml/l): 5.668 - 6.964
  Phosphate (umol/l): 0.039 - 0.546
  Silicate (umol/l): 9.677 - 28.168

Graphical representation

Depth range (m): 0 - 113

Temperature range (°C): 7.556 - 13.949

Nitrate (umol/L): 0.437 - 0.693

Salinity (PPS): 18.292 - 38.154

Oxygen (ml/l): 5.668 - 6.964

Phosphate (umol/l): 0.039 - 0.546

Silicate (umol/l): 9.677 - 28.168
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Present on shells or under stones at low water of spring tides on sheltered shores in south-west England, and in the sublittoral on stones and shell gravel associated with soft substrata down to 20 m on the west coast of England.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptraea chinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATATTTTATTTGGTATGTGGTCTGGTTTAGTTGGTACTGCCTTAAGTTTACTAATTCGTGCTGAATTAGGTCAACCAGGTGCTCTTTTAGGTGAT---GATCAATTATATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTTTAGTAATGCCTATAATAATTGGTGGTTTTGGAAATTGACTGGTTCCATTAATATTAGGTGCACCTGACATAGCTTTTCCTCGATTAAATAATATAAGTTTCTGGTTACTTCCTCCTGCTTTACTATTATTACTTTCTTCTGCAGCTGTTGAAGGTGGTGTAGGAACAGGTTGAACTGTATATCCTCCTTTATCAAGCAATTTAGCTCATGCTGGTGGTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTGTTTCTTCAATTTTAGGTGCTGTAAATTTTATTACCACTGTGGTTAATATACGATGATTTGGAATACAATTTGAACGTTTACCTTTGTTTGTATGGTCAGTAAAAATTACGGTTATTTTACTTTTACTCTCATTGCCTGTTTTAGCGGGGGCTATTACGATGCTACTTACTGATCGTAACTTCAATACTGCATTTTTTGATCCTGCTGGNGGNGGNGATCCTATCTTGTATCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Calyptraea chinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Calyptraea chinensis

Calyptraea chinensis, common name the Chinese hat snail or Chinese hat shell, is a species of small sea snail, a marine gastropod mollusk in the family Calyptraeidae, the slipper snails or slipper limpets, cup-and-saucer snails, and Chinese hat snails.[1][2]

Description[edit]

The thin shell of this species has the shape of an almost symmetrical cone (like a Chinese hat or conical Asian hat), 7 mm high and 15 – 21 mm wide. The internal partition has a spirally curved edge which runs running from the apex to the margin of the shell, and partly covers the aperture. The presence of this internal shelf distinguishes this species easily from the true limpets. The aperture is round and adapted to the substrate. The shell is creamy white, and glossy on the inside.

Calyptraea chinensis is a filter feeder, binding fine food particles with mucus. Like all slipper limpets, this species is a protandrous hermaphrodite, but the stages of change from male to female have not been clearly defined. Unlike Crepidula fornicata (the American slipper limpet), this species does not form stacks. The males and females only come together for copulation.[3] The species does not have a pelagic larval phase. The veliger stage is passed in capsules fixed to the substrate, and guarded under the shell of the parent. The young hatch as crawling post-veliger larvæ.[4]

Distribution[edit]

A fossil shell of Calyptraea chinensis from the Pliocene of Italy

Calyptraea chinensis occurs in North-West Africa, in the Mediterranean, the North Sea, the Black Sea and the Atlantic Ocean. These small snails can be found in the littoral and sublittoral zones along sheltered, rocky shores and on muddy or silty areas as long as they can cling to a hard substrate such as stones, living oysters [5] and other shells. The species also occurs on the northern and western coasts of Britain and Ireland, but is absent from the North Sea and the English Channel.

Calyptraea chinensis is known in fossil state from the Pliocene and the Early Pleistocene.[6]

References[edit]

  1. ^ a b Calyptraea chinensis (Linnaeus, 1758). Gofas, S. (2009). Calyptraea chinensis (Linnaeus, 1758). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2009) World Marine Mollusca database. Accessed through the World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&i on 2010-06-03.
  2. ^ Collins pocket guide, Sea Shore of Britain and Europe, HarperCollinsPublishers, London, 1996, ISBN 0-00-219955-6
  3. ^ Wyatt, H. V. (1961). "The Reproduction, Growth, and Distribution of Calyptraea chinensis (L.)". Journal of Animal Ecology 30 (2): 283–302. doi:10.2307/2299. JSTOR 2299. 
  4. ^ Wyatt, H.V. (April 1960). "Response of Larvæ of Calyptraea chinensis (L) to Light". Nature 186 (328): 328. doi:10.1038/186328a0. Retrieved 2010-06-04. 
  5. ^ Minchin, D.; J.D. Nunn (April 2006). "Further Range Extensions of the Marine Gastropod Calyptraea chinensis (L.) in Ireland". The Irish Naturalists' Journal 28 (5): 200–203. JSTOR 25536712. 
  6. ^ Norton P.E.P., Marine Molluscan Assemblages in the Early Pleistocene of Sidestrand, Bramerton and the Royal Society Borehole at Ludham, Norfolk, Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, Vol. 253, No. 784 (Dec. 21, 1967), pp. 161-200
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!