Overview

Brief Summary

Caenorhabditis elegans is a small (~1mm long) nematode worm (roundworm) in the family Rhabditidae. It is cosmopolitan in distribution, with reproductive stages found most reliably in rotting fruits and surrounding soil. When food is plentiful, a fertilized egg completes embryogenesis, passes through four larval stages, and attains reproductive maturity in only three days at room temperature. As with most terrestrial nematodes, under stressful conditions an alternative third larval stage specialized for dispersal, the dauer larva, may be formed. In soil, C. elegans is often found in the dauer form. The reproductive mode of C. elegans involves a mixture of self-fertile hermaphrodites and males (this system was derived relatively recently from an ancestral male/female system). The transparency, anatomical simplicity, rapid development, and mix of outcrossing and selfing in C. elegans led American nematologist Ellsworth Dougherty and British molecular geneticist Sydney Brenner to champion this species as a model organism for basic biological research beginning in the 1970s. By the early 1980's, Brenner and colleagues had carried out pioneering studies investigating the invariant cell lineages, neuroanatomy, and aspects of the genome of C. elegans. This rich body of work garnered the attention of many more researchers and quickly led to C. elegans becoming one of the most widely studied laboratory organisms in the fields of genetics, cell biology, development, aging, evolution, and neuroscience. In 1998, C. elegans became the first animal to have its entire genome sequence determined and it remains at the forefront of functional genomics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Eric S. Haag

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Caenorhabditis elegans live in temperate regions in many parts of the world (Nicholas 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Caenorhabditis elegans have elongated cylindrical bodies, tapered at both ends, with smooth skin, no segmentation, and no appendages. Adults grow to approximately 1mm in length. Exactly 959 cells compose Caenorhabditis elegans, and their bodies are transparent; therefore, individual cells are easily observed with a microscope (Edgley 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Caenorhabditis elegans are terrestrial organisms. They live primarily in soil (Lee & Atkinson 1977). The soil must have a constant level of moisture, so that the worm can move in the film of water and draw water from the soil. The soil must also have a moderate oxygen content. Worms may not be able to penetrate soils with high clay content. For ideal movement, the worm should be about three times as long as the diameter of the soil particles ( Nicholas 1975). Worms are also found in or on rotting vegetation above ground (Edgley 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Caenorhabditis elegans are bacteriovorous; they feed on various types of bacteria that live in soil and on rotting vegetation. They feed by ingesting bacteria in suspension or on detritus (Nicholas 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
0.16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 0.16 years (captivity) Observations: These animals are free-living nematodes usually found in the soil of temperate environments. Temperature influences the lifespan of the roundworm with higher temperatures shortening lifespan and lower temperatures extending lifespan, at least until a certain threshold (Klass 1977). Several genetic manipulations have succeeded in extending the longevity of the roundworm, but many of these take into account the dauer stage, which involves a developmental arrest (Klass and Hirsh 1976). As such, the maximum longevity is a conservative estimate. Although physiological ageing has been described in roundworms, the cause of death of old animals remains a mystery.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Caenorhabditis elegans have two naturally occurring sexes, a male and a self-fertilizing hermaphrodite; females do not naturally occur. The majority of individuals are hermaphrodites; males usually comprise no more than 0.20% of the natural population. The number of males can be increased, however, by raising the temperature at the onset of sexual maturity (Nicholas 1975). Hermaphrodites are protandrous; the individuals produce sperm first and then produce eggs (Blaxter 1999). Most commonly, worms will simply fertilize their own eggs (Bird 1991). However, the males that do exist copulate with hermaphrodites, thus mixing up the gene pool in the population (Nicholas 1975). Eggs are laid within two to three hours of fertilization and hatch approximately twelve hours later. The worms develop into adults in four larval stages; this generally takes about three days when the temperature ranges from 20 to 25 degrees Celsius (Blaxter 1999). Temperature plays a major role in the development of Caenorhabditis elegans. The worms' average lifespan is two to three weeks (Edgley 1999).

Images of Caenorhabditis elegans and sperm:   http://www.mcb.arizona.edu/Wardlab/gallery.html (Muhlrad 1998)

Average age at sexual or reproductive maturity (male)

Sex: male:
3 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
3 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caenorhabditis elegans

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBNM0031-06|AB167462|Caenorhabditis elegans| CGACAATGATTATTTTCTACCAATCACAAAGATATTGGAACTCTATATTTAATTTTTGGGGCCTGGTCCGCCATAGTGGGAACAGCCCTT---AGAATACTAATCCGAGCAGAGTTAGGACAACCTGGTAGTTTAATTGGAGAT---GACCAGATCTACAACGTTATTGTCACTGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAATTATGATTGGAGGATTCGGCAATTGACTTCTCCCCCTAATA---TTAGGGGCCCCTGACATGGCCTTCCCTCGTCTTAACAATATAAGTTTCTGACTTCTTCCTCCCGCCCTTATACTACTAATTAGAGGTTCCTTGGTAGAAGCAGGAGCAGGTACTGGGTGAACCGTCTACCCTCCTCTAGCCAGTAATATTGCTCACTCGGGAGCTTCAGTAGATTTA---ACCATCTTCTCCCTTCACTTGGCTGGGGCTTCCTCTATTCTTGGGGCTATTAATTTTATGTCCACAGTAATTAACATACGAGCAGAAACTCTAACATTTGACCGTCTCCCCTTATTTGTATGAAGAGTTTTTGTAACCGTAATTCTCCTTCTTCTTTCCCTTCCTGTTCTGGCAGGA---GCCATTACAATACTTCTTACCGATCGGAACTTAAATACATCATTTTTTGATCCTACCGGAGGAGGGGACCCTATTCTTTATCAACACCTATTTTGATTTTTCGGCCATCCTGAAGTCTACATTTTAATTCTTCCTGCTTTCGGCATGATTTCACATATTGTTGCCAGAGAAAGAGGTAAAAAA---GAATCATTTGGCACTCTAGGAATAATTTATGCCATTATCGCAATTGGAATTCTAGGATTCGTTGTATGAGCTCACCACATATTTACTGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caenorhabditis elegans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Species: 19
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Caenorhabditis elegans are not endangered or threatened; they are found in large numbers in nature.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species has no known negative impact on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Caenorhabditis elegans are used often in scientific research; they are considered a model organism and are easy to study due to their transparency. They are bred for use as laboratory specimens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Caenorhabditis elegans

Caenorhabditis elegans (play /ˌsnɵræbˈdtɨs ˈɛlɨɡænz/) is a free-living, transparent nematode (roundworm), about 1 mm in length,[2] which lives in temperate soil environments. Research into the molecular and developmental biology of C. elegans was begun in 1974 by Sydney Brenner and it has since been used extensively as a model organism.[3]

Contents

Biology

Movement of Wild-type C. elegans

C. elegans is unsegmented, vermiform, and bilaterally symmetrical, with a cuticle integument, four main epidermal cords and a fluid-filled pseudocoelomate cavity. Members of the species have many of the same organ systems as other animals. In the wild, they feed on bacteria that develop on decaying vegetable matter. C. elegans has two sexes: hermaphrodites and males.[4] Individuals are almost all hermaphrodite, with males comprising just 0.05% of the total population on average. The basic anatomy of C. elegans includes a mouth, pharynx, intestine, gonad, and collagenous cuticle. Males have a single-lobed gonad, vas deferens, and a tail specialized for mating. Hermaphrodites have two ovaries, oviducts, spermatheca, and a single uterus.

C. elegans eggs are laid by the hermaphrodite. After hatching, they pass through four juvenile stages (L1–L4). When crowded or in the absence of food, C. elegans can enter an alternative third larval stage called the dauer state. Dauer larvae are stress-resistant and do not age. Hermaphrodites produce all their sperm in the L4 stage (150 sperm per gonadal arm) and then switch over to producing oocytes. The sperm are stored in the same area of the gonad as the oocytes until the first oocyte pushes the sperm into the spermatheca (a chamber where the oocytes become fertilized by the sperm).[5] The male can inseminate the hermaphrodite, which will use male sperm preferentially (both types of sperm are stored in the spermatheca). When self-inseminated, the wild-type worm will lay approximately 300 eggs. When inseminated by a male, the number of progeny can exceed 1,000. At 20 °C, the laboratory strain of C. elegans has an average life span of approximately 2–3 weeks and a generation time of approximately 4 days.

C. elegans has five pairs of autosomes and one pair of sex chromosomes. Sex in C. elegans is based on an X0 sex-determination system. Hermaphrodite C. elegans have a matched pair of sex chromosomes (XX); the rare males have only one sex chromosome (X0). The sperm of C. elegans is ameboid, lacking flagella and acrosomes.

C. elegans is notable in animal sleep studies as the most primitive organism in which sleep-like states have been observed. In C. elegans, a lethargus phase occurs in short periods preceding each moult.

Longitudinal section through the hermaphrodite C. elegans

Ecology

The different Caenorhabditis species occupy various nutrient- and bacteria-rich environments. They do not form self-sustaining populations in soil, as it lacks enough organic matter. C. elegans can survive on a diet of a variety of kinds of bacteria (not all bacteria, though), but its wild ecology is largely unknown. Most laboratory strains were found in human-made environments such as gardens and compost piles. Recently, however, C. elegans has been found to be abundant in rotting organic matter, particularly rotting fruit.[6] Dauer larvae can be transported by invertebrates including millipedes, insects, isopods, and gastropods. When they reach a desirable location they then get off, and at least in the lab they will also feed on the host if it dies.[7]

Nematodes are capable of surviving desiccation, and in C. elegans the mechanism for this capability has been demonstrated to be Late Embryogenesis Abundant (LEA) proteins.[8]

Laboratory uses

In 1963 Sydney Brenner proposed using Caenorhabditis elegans as a model organism for the investigation of animal development including neural development. Brenner chose it mainly because it is simple, easy to grow in bulk populations, and convenient for genetic analysis.[9]

C. elegans is studied as a model organism for a variety of reasons. It is a multicellular eukaryotic organism that is simple enough to be studied in great detail. Strains are cheap to breed and can be frozen. When subsequently thawed, they remain viable, allowing long-term storage.[10]

In addition, C. elegans is transparent, facilitating the study of cellular differentiation and other developmental processes in the intact organism. The males can be easily distinguished from hermaphrodites based on the morphology of the tail region. The developmental fate of every single somatic cell (959 in the adult hermaphrodite; 1031 in the adult male) has been mapped out.[11][12] These patterns of cell lineage are largely invariant between individuals, in contrast to mammals, where cell development from the embryo is more largely dependent on cellular cues. In both sexes, a large number of additional cells (131 in the hermaphrodite, most of which would otherwise become neurons), are eliminated by programmed cell death (apoptosis). This aspect has been thoroughly studied in this organism, specifically because of this "apoptotic predictability", which has contributed to the elucidation of some apoptotic genes, mainly through observation of abnormal, apoptosis-surviving nematodes.

Wild-type C. elegans hermaphrodite stained with the fluorescent dye Texas Red to highlight the nuclei of all cells

In addition, C. elegans is one of the simplest organisms with a nervous system. In the hermaphrodite, this comprises 302 neurons[13] whose pattern of connectivity, or "connectome", has been completely mapped and shown to be a small-world network.[14] Research has explored the neural mechanisms responsible for several of the more interesting behaviors shown by C. elegans, including chemotaxis, thermotaxis, mechanotransduction, and male mating behavior.

A useful feature of C. elegans is that it is relatively straightforward to disrupt the function of specific genes by RNA interference (RNAi). Silencing the function of a gene in this way can sometimes allow a researcher to infer what the function of that gene may be. The nematode can either be soaked in or injected with a solution of double stranded RNA, the sequence of which is complementary to the sequence of the gene that the researcher wishes to disable. Alternatively, worms can be fed on genetically transformed bacteria which express the double stranded RNA of interest.

C. elegans has also been useful in the study of meiosis. As sperm and egg nuclei move down the length of the gonad, they undergo a temporal progression through meiotic events. This progression means that every nucleus at a given position in the gonad will be at roughly the same step in meiosis, eliminating the difficulties of heterogeneous populations of cells.

The organism has also been identified as a model for nicotine dependence as it has been found to exhibit behavioral responses to nicotine that parallel those observed in mammals, including acute response, tolerance, withdrawal, and sensitization.[15]

As for most model organisms, there is a dedicated online database for the species that is actively curated by scientists working in this field. The WormBase database attempts to collate all published information on C. elegans and other related nematodes. A reward of $4000 has been advertised on their website, for the finder of a new species of closely related nematode.[16] Such a discovery would broaden research opportunities with the worm.[17]

Long-term storage

A 15% glycerol solution is used for the freezing of C. elegans. Samples are cooled at 1°C per minute. Freshly-starved young larvae survive freezing best. About 35% to 45% of the worms stored in liquid nitrogen survive. The worms can also be stored at −80°C for over ten years, but survival is not as great as for worms stored at −196°C, the temperature of liquid nitrogen.[18]

In space travel research

C. elegans made news when it was discovered that specimens had survived the Space Shuttle Columbia disaster in February 2003.[19] Later, in January 2009, it was announced that live samples of C. elegans from the University of Nottingham would spend two weeks on the International Space Station that October as part of a project to explore the effects of zero gravity on muscle development and its physiology. The emphasis of the research was to be on the genetic basis of muscle atrophy. This has relevance to space travel, but also to individuals who are bed-ridden, geriatric or diabetic.[20] Descendants of the worms that were aboard Columbia in 2003 were launched into space on Endeavour for the STS-134 mission.[21]

Genome

C. elegans was the first multicellular organism to have its genome completely sequenced. The sequence was published in 1998,[22] although a number of small gaps were present; the last gap was finished by October 2002. The adult hermaphrodite has 959 somatic nuclei. Its gene density is about 1 gene/5kb. Introns are 26% of the genome. There are some large intergenic regions containing repetitive DNA sequences. Many genes are arranged in operons: polycistronic series that are transcribed together. C. elegans and other nematodes are among the few eukaryotes currently known to have operons.[23] The C. elegans genome sequence is approximately 100 million base pairs long. The genome consists of 6 chromosomes (named I, II, III, IV, V and X) and a Mitochondrion.

The genome contains approximately 20,470 protein-coding genes.[24] The number of known RNA genes in the genome has increased greatly due to the 2006 discovery of a new class of 21U-RNA gene,[25] and the genome is now believed to contain more than 16,000 RNA genes, up from as few as 1,300 in 2005.[26] Scientific curators continue to appraise the set of known genes, such that new gene predictions continue to be added and incorrect ones modified or removed.

In 2003, the genome sequence of the related nematode C. briggsae was also determined, allowing researchers to study the comparative genomics of these two organisms.[27] Work is now ongoing to determine the genome sequences of more nematodes from the same genus such as C. remanei,[28] C. japonica[29] and C. brenneri.[30] These newer genome sequences are being determined using the whole genome shotgun technique which means they are likely to be less complete and less accurate than that of C. elegans, which was sequenced using the "hierarchical" or clone-by-clone approach.

The official version of the C. elegans genome sequence continues to change as new evidence reveals errors in the original sequencing; DNA sequencing is not an error-free process. Most changes are minor, adding or removing only a few base pairs (bp) of DNA. For example, the WS202 release of WormBase (April 2009) added 2 base pairs to the genome sequence.[31] Occasionally, more extensive changes are made, as in the WS197 release of December 2008, which added a region of over 4,600 bp to the sequence.[32][33]

Evolution

It has been shown that a small number of conserved protein sequences from sponges are more similar to humans than to C. elegans.[34] This suggests that there has been an accelerated rate of evolution in the C. elegans lineage. The same study found that several phylogenetically ancient genes are not present in C. elegans.

RNA interference

RNA interference (RNAi) has been used extensively in C. elegans because it can be done by simply feeding the worms transgenic bacteria expressing RNA complementary to the gene of interest. Their relative simplicity makes gene loss-of-function experiments in C. elegans the easiest of all animal models, and thus, scientists have been able to knock down 86% of the ~20,000 genes in the worm, establishing a functional role for 9% of the genome.[35]

Incidentally, RNAi does not work nearly as well in other species of worm in the Caenorhabditis genus. Although injecting RNA into the body cavity of the animal induces silencing in most species, only C. elegans and a few other distantly-related nematodes can uptake RNA from the bacteria they eat for RNAi.[36] This ability has been mapped down to a single gene, sid-2, which when inserted as a transgene in other species, allows them to uptake RNA for RNAi the way C. elegans does.[37]

Scientific community

C. elegans hermaphrodite

In 2002, the Nobel Prize in Physiology or Medicine was awarded to Sydney Brenner, H. Robert Horvitz and John Sulston for their work on the genetics of organ development and programmed cell death in C. elegans. The 2006 Nobel Prize in Physiology or Medicine was awarded to Andrew Fire and Craig C. Mello for their discovery of RNA interference in C. elegans.[38] In 2008, Martin Chalfie shared a Nobel Prize in Chemistry for his work on green fluorescent protein in C. elegans.

Because all research into C. elegans essentially started with Sydney Brenner in the 1970s, many scientists working in this field share a close connection to Brenner, having either worked as a post-doctoral or post-graduate researcher in Brenner's lab or in the lab of someone who previously worked with Brenner. Because most people who worked in his lab went on to establish their own worm research labs, there is now a fairly well documented "lineage" of C. elegans scientists. This lineage was recorded in some detail at the 2003 International Worm Meeting and the results were stored in the WormBase database.

See also

References

  1. ^ Maupas, Émile (1900). "Modes et formes de reproduction des nematodes". Archives de Zoologie Expérimentale et Générale 8: 463–624. http://www.wormbase.org/papers/1900-maupas/index.html. Retrieved 2009-05-27. 
  2. ^ Wood, William Barry (1988). "Chapter 1: Introduction to C. elegans Bioloogy". In Wood, William Barry. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press. p. 1. ISBN 0-87969-433-5. http://books.google.com/?id=LTEPi6VlZZkC&dq=Caenorhabditis+elegans+length&printsec=frontcover&q=Caenorhabditis%20elegans%20length. Retrieved 2009-12-13. 
  3. ^ Brenner, S. (May 1974). "The Genetics of Caenorhabditis elegans" (PDF). Genetics 77 (1): 71–94. PMC 1213120. PMID 4366476. http://dev.wormbase.org/papers/31_Brenner74.pdf. 
  4. ^ Alberts, B. et al. (2008). Molecular Biology of the Cell, 5th edition. Chapter 22, page 1321.
  5. ^ Nayak, S; Goree, J; Schedl, T (Jan 2004). "fog-2 and the Evolution of Self-Fertile Hermaphroditism in Caenorhabditis". PLoS Biology 3 (1): e6. doi:10.1371/journal.pbio.0030006. ISSN 1544-9173. PMC 539060. PMID 15630478. http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030006. 
  6. ^ Félix, MA, M; Braendle C, C (Nov 2010). "The natural history of Caenorhabditis elegans". Current Biology 20 (22): R965–R969. doi:10.1016/j.cub.2010.09.050. PMID 21093785. 
  7. ^ Kiontke, K, K; Sudhaus, W, W (Jan 2006). "Ecology of Caenorhabditis species". WormBook : the online review of Elegans biology: 1–14. doi:10.1895/wormbook.1.37.1. PMID 18050464. 
  8. ^ Gal TZ, Glazer I, Koltai H (2004). "An LEA group 3 family member is involved in survival of C. elegans during exposure to stress". FEBS Letters 577 (1–2): 21–26. doi:10.1016/j.febslet.2004.09.049. PMID 15527756. 
  9. ^ Leon Avery. "Sydney Brenner". http://elegans.swmed.edu/Sydney.html. 
  10. ^ Brenner S. (May 1974). "The Genetics of Caenorhabditis elegans". Genetics 77 (1): 71–94. PMC 1213120. PMID 4366476. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1213120. 
  11. ^ Sulston JE, Horvitz HR (March 1977). "Post-embryonic cell lineages of the nematode, Caenorhabditis elegans". Dev. Biol. 56 (1): 110–56. doi:10.1016/0012-1606(77)90158-0. PMID 838129. 
  12. ^ Kimble J, Hirsh D (June 1979). "The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans". Dev. Biol. 70 (2): 396–417. doi:10.1016/0012-1606(79)90035-6. PMID 478167. 
  13. ^ Kosinski, R. A.; M. Zaremba (2007). "Dynamics of the Model of the Caenorhabditis elegans Neural Network". Acta Physica Polonica B 38 (6): 2202. http://th-www.if.uj.edu.pl/acta/vol38/pdf/v38p2201.pdf. Retrieved 2009-07-31. 
  14. ^ Watts, DJ; Strogatz, SH (June 1998). "Collective dynamics of 'small-world' networks". Nature 393 (6684): 440–442. Bibcode 1998Natur.393..440W. doi:10.1038/30918. ISSN 0028-0836. PMID 9623998. http://www.nature.com/nature/journal/v393/n6684/abs/393440a0.html. 
  15. ^ Feng et al., Z; Li, W; Ward, A; Piggott, BJ; Larkspur, ER; Sternberg, PW; Xu, XZ (November 2006). "A C. elegans model of nicotine-dependent behavior: regulation by TRP family channels". Cell 127 (3): 621–633. doi:10.1016/j.cell.2006.09.035. ISSN 0092-8674. PMC 2859215. PMID 17081982. http://www.cell.com/content/article/abstract?uid=PIIS0092867406012955. 
  16. ^ "Caenorhabditis isolation guide". WormBase. http://wormbase.org/external/2007/nematode_isolation_guide/nematode_isolation_guide.html. Retrieved 2007-08-30. [dead link]
  17. ^ Dolgin, Elie (August 2007). "Slime for a dime". Science 317 (5842): 1157. doi:10.1126/science.317.5842.1157b. 
  18. ^ Stiernagle, Theresa (February 11, 2006). "Maintenance of C. elegans". 7. Freezing and recovery of C. elegans stocks. WormBook. http://www.wormbook.org/chapters/www_strainmaintain/strainmaintain.html. Retrieved 2010-10-05. 
  19. ^ "Worms survived Columbia disaster". BBC News. 2003-05-01. http://news.bbc.co.uk/1/hi/sci/tech/2992123.stm. Retrieved 2008-07-11. 
  20. ^ "University sends worms into space". BBC News. 2009-01-17. http://news.bbc.co.uk/1/hi/england/nottinghamshire/7835020.stm. Retrieved 2009-07-09. 
  21. ^ "Descendants of 2003 Shuttle Columbia disaster launched into space". Discovery News. 2011-05-16. http://news.discovery.com/space/legacy-space-worms-flying-on-shuttle-110516.html. Retrieved 2011-05-17. 
  22. ^ The C. elegans Sequencing Consortium, Consortium (Dec 1998). "Genome sequence of the nematode C. elegans: a platform for investigating biology". Science 282 (5396): 2012–2018. doi:10.1126/science.282.5396.2012. ISSN 0036-8075. PMID 9851916. http://www.sciencemag.org/cgi/content/abstract/282/5396/2012. 
  23. ^ Blumenthal, T. (2004). "Operons in eukaryotes". Briefings in Functional Genomics and Proteomics 3 (3): 199–211. doi:10.1093/bfgp/3.3.199. PMID 15642184.  edit
  24. ^ "WS227 Release Letter". WormBaseWiki. http://www.wormbase.org/wiki/index.php/WS227. Retrieved 2011-08-26. 
  25. ^ Ruby, J.; Jan, C.; Player, C.; Axtell, M.; Lee, W.; Nusbaum, C.; Ge, H.; Bartel, D. (2006). "Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in Elegans". Cell 127 (6): 1193–1207. doi:10.1016/j.cell.2006.10.040. PMID 17174894.  edit
  26. ^ http://wormbook.org/chapters/www_noncodingRNA/noncodingRNA.html
  27. ^ Stein, LD; Bao, Z; Blasiar, D; Blumenthal, T; Brent, MR; Chen, N; Chinwalla, A; Clarke, L et al (Nov 2003). "The Genome Sequence of Caenorhabditis briggsae: A Platform for Comparative Genomics" (Free full text). PLoS Biology 1 (2): 166–192. doi:10.1371/journal.pbio.0000045. ISSN 1544-9173. PMC 261899. PMID 14624247. http://dx.plos.org/10.1371/journal.pbio.0000045. 
  28. ^ Genome Sequencing Center. "Caenorhabditis remanei: Background". Washington University School of Medicine. Archived from the original on 2008-06-16. http://web.archive.org/web/20080616091639/http://genome.wustl.edu/genome.cgi?GENOME=Caenorhabditis+remanei. Retrieved 2008-07-11. 
  29. ^ Genome Sequencing Center. "Caenorhabditis japonica: Background". Washington University School of Medicine. Archived from the original on 2008-06-26. http://web.archive.org/web/20080626053444/http://genome.wustl.edu/genome.cgi?GENOME=Caenorhabditis+japonica. Retrieved 2008-07-11. 
  30. ^ Genome Sequencing Center. "Caenorhabditis brenneri: Background". Washington University School of Medicine. http://genome.wustl.edu/genome.cgi?GENOME=Caenorhabditis%20brenneri. Retrieved 2008-07-11. [dead link]
  31. ^ "WormBaseWiki WS202 release notes". Wormbase. http://www.wormbase.org/wiki/index.php/WS202. Retrieved 2009-04-28. 
  32. ^ "WormBaseWiki WS197 release notes". Wormbase. http://www.wormbase.org/wiki/index.php/WS197. Retrieved 2008-12-26. 
  33. ^ "WormBaseWiki Genome sequence changes". Wormbase. http://www.wormbase.org/wiki/index.php/Genome_sequence_changes. Retrieved 2011-08-13. 
  34. ^ Gamulin, V; Muller, Isabel M.; Muller, Werner E.G. (December 2000). "Sponge proteins are more similar to those of Homo sapiens than to Caenorhabditis elegans". Biological Journal of the Linnean Society (Academic Press) 71 (4): 821–828. doi:10.1111/j.1095-8312.2000.tb01293.x. 
  35. ^ Kamath, R.; Fraser, A.; Dong, Y.; Poulin, G.; Durbin, R.; Gotta, M.; Kanapin, A.; Le Bot, N. et al (2003). "Systematic functional analysis of the Caenorhabditis elegans genome using RNAi". Nature 421 (6920): 231–237. doi:10.1038/nature01278. PMID 12529635.  edit
  36. ^ Félix, M. -A. (2008). "RNA interference in nematodes and the chance that favored Sydney Brenner". Journal of biology 7 (9): 34. doi:10.1186/jbiol97. PMC 2776389. PMID 19014674. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2776389.  edit
  37. ^ Winston, W.; Sutherlin, M.; Wright, A.; Feinberg, E.; Hunter, C. (2007). "Caenorhabditis elegans SID-2 is required for environmental RNA interference.". Proceedings of the National Academy of Sciences of the United States of America 104 (25): 10565–10570. Bibcode 2007PNAS..10410565W. doi:10.1073/pnas.0611282104. PMC 1965553. PMID 17563372. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1965553.  edit
  38. ^ Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC, A (February 1998). "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans". Nature 391 (6669): 806–11. Bibcode 1998Natur.391..806F. doi:10.1038/35888. ISSN 0028-0836. PMID 9486653. 

Publications

Online resources

Nobel lectures

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!