Overview

Comprehensive Description

Description

 Acanthochitona crinita is an oval shaped chiton with a flattened elongate body up to 3.4 cm long. The body is protected by a shell composed of eight interlocked transverse, coarsely keeled plates or valves. These can vary in colouration and combination from off-white, yellowish-brown, olive-green, pinkish or marbled. This species has a white v-shaped area in the centre of the valves. The shell valves possess notches, with five typically on the anterior margin of the head valve. The intermediate valves are short and wing-like, whereas the tail valve is small and oval. Each of the shell plates/valves are covered with irregularly distributed tubercles of various sizes.  

The broad girdle is fringed with 18-20 dense tufts of colourless bristles, four surrounding the head valve and two at each valve intersection. There are short spines and randomly distributed curves spines that also cover the remainder of the girdle. In the posterior region of the mantle groove there are 10-15 pairs of gills.

'Coat-of-mail' shells get they're name from the armoured appearance of the valves like links in chain mail. These eight valves allow Acanthochitona crinita to bend and tightly cling onto uneven rock surfaces. When dislodged, they roll up like woodlice.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 3.5 - 3.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 13 specimens in 2 taxa.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 58
  Temperature range (°C): 11.471 - 11.855
  Nitrate (umol/L): 4.850 - 6.151
  Salinity (PPS): 35.184 - 35.211
  Oxygen (ml/l): 6.128 - 6.200
  Phosphate (umol/l): 0.336 - 0.421
  Silicate (umol/l): 2.315 - 3.285

Graphical representation

Depth range (m): 0 - 58

Temperature range (°C): 11.471 - 11.855

Nitrate (umol/L): 4.850 - 6.151

Salinity (PPS): 35.184 - 35.211

Oxygen (ml/l): 6.128 - 6.200

Phosphate (umol/l): 0.336 - 0.421

Silicate (umol/l): 2.315 - 3.285
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Acanthochitona crinita can be found firmly attached to the underside of rocks on the lower shore and sublittoral down to 50 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

Confusion about the name: A. communis and A. crinita wered referred to as Chiton fascicularis according to Van Belle (1982) and Van Aartsen et al. (1984)
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthochitona crinita

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTGGTACTTTATATATTTTGTTTGGAATTTGATCTGGCTTGGTTGGTACAGCTTTAAGTTTATTAATTCGAGCAGAATTAGGGCAACCTGGAGCATTATTAGGTGAT---GATCAGTTATATAATGTTATTGTTACTGCCCATGCTTTCGTAATGATTTTTTTTTTAGTAATGCCTATAATAATTGGTGGTTTTGGAAATTGGCTTGTACCTTTAATATTGGGGGCTCCTGATATAGCTTTTCCTCGTTTAAATAATATAAGTTTTTGATTGCTTCCCCCTTCTTTGTGTTTATTATTAGCCTCTGGTGCTGTTGAGAGAGGGGTTGGTACTGGGTGAACGGTTTATCCTCCATTAGCTGGGAATGTAGCTCATGCTGGTGGTTCAGTCGATCTTGCTATTTTTTCTTTACATTTAGCTGGAGTTTCTTCTATTTTAGGTGCTGTAAATTTTATTACTACTGTTTTAAATATGCGTTGGAGTGGAATGCAATTGGAACGATTACCGTTGTTTGTATGGTCAGTAAAAATTACTGCGGTTCTTCTTTTATTATCTTTACCTGTTCTTGCTGGAGGGATTACTATACTTTTAACTGACCGTAATTTTAATACTGCTTTTTTTGATCCTGCGGGAGGTGGAGATCCTATTTTATATCAACATTTATTTTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthochitona crinita

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!