Overview

Brief Summary

The gumboot chiton (Cryptochiton stelleri), also called the Great Pacific Chiton, is a mollusk of class Polyplacophora. Most recognizable by its physical appearance (which has earned it its nickname, the “wandering meatloaf”), C. stelleri is a fairly common sight in tide pools and shallows around the northern regions of the Pacific Rim. (1)

  • (1) "OceanLink | Biodiversity - Gumboot Chiton." OceanLink | Marine Sciences Education and Fun. N.p., n.d. . 15 Nov. 2010.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: Brooks Donohue

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology/Natural History: As with all chitons, this species can grip the rocks tightly. Its grip is not nearly as strong for its size as is that of many other species, however. With work one can usually dislodge it. Unlike some other chiton species, Cryptochiton stelleri has well-developed ctenidia (gills) in the pallial groove beside the foot. They often raise the edge of their mantle when in air, perhaps to facilitate respiration. The commensal polychaete worm Arctonoe vittata or A. pulchra can sometimes be found in their pallial groove, as can the pea crab Opisthopus transversus. O'clair and O'Clair report no commensals in this species in SE Alaska. Spawn from March to May in California., laying eggs in gelatinous, cinnamon-red spiral strings up to 1 m long. The egg strings do not stick and are quickly broken up by the waves. When females release their eggs, nearby males are stimulated to release sperm into the water. After hatching, larvae swim for about 20 h before settling. Adults do not move far (less then 20 m in 2 years in one experiment) and may live 20 years or more. Some individuals have algae growing on their mantle. Feeds mostly on various red algae, and also on some brown and green algae. Predators include the snail Ocenebra lurida, tidepool sculpins. Sea otters seem to ignore it, but river otters will eat it.. Indian tribes often ate it. 44% of body weight is blood. The radular teeth are hardened with a magnetite cap. Named after Georg Wilhelm Steller, an early Russian naturalist in Alaska.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A very large chiton (world's largest). All 8 plates are completely covered by the mantle. Up to 33 cm long. Mantle is thick and leathery. Dorsal surface is usually a brown or brick red, sometimes with lighter blotches; underside is orange or yellow (picture). The butterfly-shaped valve plates are white or robin's egg blue, are occasionally washed up on the beach.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The cryptochiton stelleri was named after Georg Wilhelm Steller, who was a Russian naturalist living in Alaska. (1)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: JulianaSchiffgen

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Alaska to Channel Islands, California to Japan

Biogeographic Regions: oriental (Native ); oceanic islands (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographical Range: Aleutian Islands to San Nicolas Island, CA, Kamchatka, Kurile Islands, Japan

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Commonly called the gumboot "chiton," Cryptochiton stelleri is the world's largest chiton species, reaching a length of 14 inches.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Has eight butterfly-shaped valves plates.(2) The valve plates often break, but the Chiton can repair them. (3) The plates are covered by a thick and leathery mantle. The dorsal surface is usually red/brown, while the underside is usually yellow or orange (2) The lighter fibrous parts around the edges are the Chiton’s gills. (4)
Considered the most highly modified Chiton, and can weigh around 4.4 pounds(1)
About 44% of their body weight is blood (2)
The radular teeth are hardened by a magnetite cap. (2) The teeth have so much magnetite in them that they can be picked up by a magnet (3)
During low tide, the Chiton can absorb oxygen from the atmosphere if necessary. (3)
It can live for up to 25 years. (4)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: Sarah Johnson

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: No other chiton in this area has all 8 plates covered by the mantle, nor grows this large.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Among rocks, near low-tide level to water 60' (18 m) deep. May be found in shallow waters during spawning season in May.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 64 specimens in 1 taxon.
Water temperature and chemistry ranges based on 41 samples.

Environmental ranges
  Depth range (m): 0 - 4
  Temperature range (°C): 9.215 - 10.345
  Nitrate (umol/L): 5.634 - 7.608
  Salinity (PPS): 31.235 - 32.111
  Oxygen (ml/l): 6.535 - 6.794
  Phosphate (umol/l): 0.883 - 1.030
  Silicate (umol/l): 12.975 - 20.289

Graphical representation

Depth range (m): 0 - 4

Temperature range (°C): 9.215 - 10.345

Nitrate (umol/L): 5.634 - 7.608

Salinity (PPS): 31.235 - 32.111

Oxygen (ml/l): 6.535 - 6.794

Phosphate (umol/l): 0.883 - 1.030

Silicate (umol/l): 12.975 - 20.289
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: low intertidal to 20 m

Habitat: Rocky substrate, especially in kelp beds.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The stelleri hides among red algae/kelp forests for camouflage and food(1)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: JulianaSchiffgen

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Feeds on various fleshy and coraline algae such as sea lettuce, also on bryzoans and diatoms.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mostly on red algae, but sometimes feed on brown or green algae.(2)
Uses tongue-like radula to scrape algae from rocks (1)
One predator is the snail Ocenebra lurida (2)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: JulianaSchiffgen

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

The gumboot chiton lives in temperate to cold waters from the coasts of California and Japan up to Alaska and Kamchatka. (1) Much of its life is spent in tide pools, where it subsists on algae and seaweed during the nighttime. Its predators are few, although some predatory snails have been known to attempt to kill it (although few can cut farther than the outer mantle). It also has been known to have commensal relationships with some isopods and shrimp that take refuge in its gills. (1)

  • (1) Barnes, Robert D. Invertebrate zoology. 2d ed. Philadelphia: Saunders, 1968.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Brooks Donohue

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Separate sexes; males deposit sperm into water and females lay eggs in strings, clusters or spiral arrangements. Eggs may be free-floating single cells or enclosed in jelly-like capsules or strings.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gumboot chiton, like all chitons, mates externally, with the male releasing sperm and the female releasing eggs into the water. When fertilized, eggs develop through a stage as a trophoblast before growing into a juvenile. (1) Most commonly, eggs develop while free-floating, although some species retain them in the mantle cavity and one gives birth to live young. (2)

  • (1) Barnes, Robert D. Invertebrate zoology. 2d ed. Philadelphia: Saunders, 1968.
  • (2) "OceanLink | Biodiversity - Gumboot Chiton." OceanLink | Marine Sciences Education and Fun. N.p., n.d. . 15 Nov. 2010.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Brooks Donohue

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

They spawn from March to May in California, and after hatching, larvae swim for about 20 hours before settling. (1)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

Supplier: JulianaSchiffgen

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Physiology

C. stelleri translates from Latin to “Steller’s Hidden Chiton”, so named because the eight valves present in all and external in most chitons are covered by the animal’s fleshy mantle, which comes in shades of red, brown, and orange and is pebbled and tough. The chiton’s underside is largely composed of its muscular foot, flanked by its two gills on each side. The mouth and anus are at the anterior and posterior ends, respectively, although there is no head or tail to speak of. (1) (2) The nervous system is simple, with no real ganglion, although a pedal nerve cord runs the length of the creature below the foot. (2) Internally, the gumboot chiton is not unlike most other chitons. The gut extends the length of the creature, with a stomach towards the anterior end. Digestion is aided by enzymes injected into the stomach from a gland. (2) Oxygen is synthesized from the gills, then introduced into the blood via a pair of auricles (one for each gill). The blood is then pumped into the aorta (and the body) with a powerful ventricle. (1) Excretion of nitrogenous waste is accomplished through a pair of nephridia. The single gonad is large and occupies the top of the body, releasing into a pair of gonopores in front of those used by nephridia. (3)

  • (1) Barnes, Robert D. Invertebrate zoology. 2d ed. Philadelphia: Saunders, 1968.
  • (2) "ChitonAnatomy." Natural History Museum at Washington State University Tri-Cities. N.p., n.d. . 17 Nov. 2010.
  • (3) "OceanLink | Biodiversity - Gumboot Chiton." OceanLink | Marine Sciences Education and Fun. N.p., n.d. . 15 Nov. 2010.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Brooks Donohue

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cryptochiton stelleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATATTTTATTTGGGATTTGATCGGGTTTAGTAGGAACAGCTTTAAGTTTACTTATTCGAGCTGAGTTAGGGCAACCTGGGGCTCTTTTAGGAGAT---GACCAATTATATAATGTAATTGTTACTGCTCATGCTTTTGTCATAATTTTTTTTTTAGTTATACCTATAATGATTGGGGGGTTTGGAAATTGATTAGTACCTTTAATGTTAGGAGCACCAGATATAGCGTTTCCACGGCTAAATAATATAAGTTTTTGGTTGCTGCCGCCAGCTTTATGTCTTTTATTAGCTTCGGCTTTAGTGGAAAGAGGGGCCGGTACTGGGTGGACAGTTTACCCTCCTTTAGCAAGAAATATTGCTCATGCTGGGGGGTCTGTAGATCTGGCTATTTTTTCTTTACATTTAGCAGGTGTTTCCTCTATTTTAGGGGCGGTTAATTTTATTACTACTGTGTTAAATATACGGTGGGAGGGAATACAATTAGAACGATTACCTTTGTTTGTATGATCAGTAAAAATTACAGCTATTTTATTACTTTTATCTCTACCTGTGTTGGCTGGCGGAATTACTATATTGCTAACGGACCGAAATTTTAATACTGCTTTTTTTGATCCTGCTGGAGGGGGGGATCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cryptochiton stelleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Some species of chitons are often found in Indian and West Indian foods, and they are used as bait.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gumboot chiton

The gumboot chiton, Cryptochiton stelleri, also known as the Giant Western Firey Chiton, is the largest of the chitons, growing to 36 cm (14 in) and over 2 kg (4.4 lb). It is found along the shores of the northern Pacific Ocean from Central California to Alaska, across the Aleutian Islands to the Kamchatka Peninsula and south to Japan.[1] It inhabits the lower intertidal and subtidal zones of rocky coastlines.

Chitons are molluscs which have eight armored plates (called valves) running in a flexible line down their back. Unlike most chitons, the gumboot's valves are completely hidden by its leathery upper skin or girdle, which is usually reddish-brown, brown, and occasionally orange in color. The gumboot chiton's appearance has led some tidepoolers to fondly refer to it as the "wandering meatloaf."

Names[edit]

The name "Gumboot Chiton" seems to derive from a resemblance to part of a rubber Wellington boot or "gum rubber" boot[2]

The Latin name Cryptochiton stelleri means Steller's hidden chiton. "Steller" is in honor of the 18th-century German zoologist Georg Wilhelm Steller, who first described many species of the northern Pacific seashore. "Hidden" or "concealed" refers to the fact that the eight shelly plates characteristic of chitons are not visible, being totally internal in this genus of chiton.[3] Many taxonomic names for chitons are based on the appearance of their plates or valves, and so it is most likely that the "hidden" portion of the name refers to the valves being completely obscured by the gumboot's girdle.[4]

Life[edit]

The underside of a live Cryptochiton stelleri, showing the foot, in the center, surrounded by the gills and mantle. The mouth is visible above and to the left of the foot.

The gumboot chiton's underside is orange or yellow and consists mostly of a large foot similar to that of other molluscs like snails or slugs, with gills found in grooves running along the outer edge of the foot.[5] The gumboot chiton is found clinging to rocks, moving slowly in search of its diet of algae, scraped off of rocks with its rasp-like retractable radula, covered with rows of magnetite-tipped teeth. It also eats other marine vegetation such as sea lettuce and giant kelp. A nocturnal creature, the gumboot generally feeds at night and often remains in a hiding place during the day — although on foggy days it may be found exposed in tide pools or on rocks.[6]

The gumboot can live for over 40 years. It has few natural predators, the most common being the lurid rocksnail, Ocenebra lurida — although the small snail's efforts to consume the chiton are generally limited to the outer mantle only. It is sometimes reported that the lurid rocksnail is in fact the gumboot chiton's only predator,[7] but others list such animals as the sea star Pisaster ochraceus,[8] some octopus species,[9][full citation needed] and the Sea Otter.[10]

Several other animal species have been observed living within the gumboot's gills; the relationship is thought to be commensal: neither harmful nor helpful to the chiton. One researcher[11] found that more than a quarter of gumboots hosted an Arctonoe vittata, a pale yellow scale worm which can grow up to 10 cm (3.9 in) length. Opisthopus transversus, a small crab, is also sometimes found within the gills.[12][full citation needed]

Human interaction[edit]

Hermit crabs and live Tegula funebralis snails on a dead Gumboot chiton, Cryptochiton stelleri, in a tide pool at low tide in central California

Its flesh is edible, and has been used as a food source by Native Americans, as well as by Russian settlers in Southeast Alaska.[6] However, it is not generally considered palatable, with a texture described as extremely tough and rubbery. The writers of Between Pacific Tides further detail the culinary drawbacks of the gumboot: "After one experiment the writers decided to reserve the animals for times of famine; one tough, paper-thin steak was all that could be obtained from a large cryptochiton, and it radiated such a penetrating fishy odor that it was discarded before it reached the frying pan."[13][full citation needed]

The gumboot chiton's bony armoring plates, called "butterfly shells" due to their shape, can sometimes be found washed up on beaches, as can whole chitons: the gumboot keeps a weaker grip on the rocks that make up its home than most chitons do, and therefore it is not unusual for them to be knocked loose in heavy waves.

References[edit]

Notes[edit]

  1. ^ Ricketts et al. p 105. Also Cowles.
  2. ^ Fields, Carmen (1999). Alaska's Seashore Creatures: A guide to selected marine invertebrates. Alaska Northwest Books. ISBN 0-88240-516-0.  p. 27.
  3. ^ BioMEDIA's Gumboot Chiton page
  4. ^ This explanation is offered by Patricia Lichen's Brittle Stars & Mudbugs p. 102 (Sasquatch Books, 2001).
  5. ^ Cowles.
  6. ^ a b Ricketts et al. p 103.
  7. ^ The Monterey Bay Aquarium reports this.
  8. ^ Taxonomy: Gumboot Chiton
  9. ^ ibid.
  10. ^ Perrin, William et al. (2002). Encyclopedia of Marine Mammals. Academic Press. ISBN 0-12-551340-2.  p 847.
  11. ^ Ricketts et al. p 105
  12. ^ ibid.
  13. ^ ibid.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!