Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

1. Paraponera clavata HNS . Pl. VII. fig. 6. B.M.

Formica clavata, Fabr. HNS Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.

Formica armata, Oliv. HNS Encycl. Meth. vi. 498. 42.

Formica spininoda, Latr. HNS Hist. Nat. Fourm. 207 [[queen]] [[worker]].

Ponera tarsalis, Perty HNS , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].

Ponera clavata, Erichs HNS . Faun, et Flo. Brit. Guiana, iii. 592.

Hab. South America (Napo); Brazil (Para).

The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 100-101, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

clavata (Fabricius HNS 1775).

Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 38-38, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Throughout the wet Neotropics. Costa Rica: Atlantic slope wet forest, low elevations; extending to just west of Santa Cecilia in northern Guanacaste Province (Janzen, pers. comm.); absent from wet forest of southern Pacific slopes and Osa.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Smith, F.:
  Formica clavata, Fabr. Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.
  Formica armata, Oliv. Encycl. Meth. vi. 498. 42.
  Formica spininoda, Latr. Hist. Nat. Fourm. 207 [[queen]] [[worker]].
  Ponera tarsalis, Perty , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].
  Ponera clavata, Erichs . Faun, et Flo. Brit. Guiana, iii. 592.
  Hab. South America (Napo); Brazil (Para).
  The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.
 

Forel, A., 1909:
 — [[ worker ]]. — Cette espece bresilienne porte avec d'autres la fausse etiquette « Guinee »!
 

Wild, A. L., 2007:
 Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ worker ]]. — Cette espece bresilienne porte avec d'autres la fausse etiquette « Guinee »!

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica clavata, Fabr. Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.

 

Formica armata, Oliv. Encycl. Meth. vi. 498. 42.

 

Formica spininoda, Latr. Hist. Nat. Fourm. 207 [[queen]] [[worker]].

 

Ponera tarsalis, Perty , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].

 

Ponera clavata, Erichs . Faun, et Flo. Brit. Guiana, iii. 592.

 

Hab. South America (Napo); Brazil (Para).

 

The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Paraponera clavata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTTAACAAT---GAGCAAATTTTTAATTCACTCGTTACTAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATCGGAGGGTTCGGTAATTTCTTAGTACCATTAATAATTGGAGCTCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTGTTACCTCCTTCATTATTTCTACTAACCTTAAGTAATTTAATTAATAATGGAGTAGGTACAGGATGAACCGTATATCCTCCTCTATCATCTAATGTATATCATAGTGGACCATCAGTAGACTTAACTATTTTCTCCTTACATATTGCAGGTATCTCATCAATTTTAGGATCAATTAATTTTATTTCTACAATTTTAAATATACACCATAAAAATTTTAGATTAGATAAAATCCCTCTATTAGTTTGATCCATCTTAATCACCACCATCCTCCTATTATTAGCCTTACCAGTTTTAGCAGGAGCCATCACAATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGACCCGTCAGGAGGAGGAGACCCCGTATTATACCAACACTTATTTTGATTTTTTGGACACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTTTAATCTCCCATATTATAATAAATGAAAGAGGTAAAAAAGAAACATTTGGGTCACTTGGAATAATTTACGCAATAATAGCTATTGGATTTTTAGGATTTGTTGTGTGAGCCCATCATATATTCACAATTGGATTAGATGTTGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Paraponera clavata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!