Articles on this page are available in 1 other language: French (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Formica clavata Fabricius, 1775: 394 (w.) AntCat AntWiki

Taxonomic history

India (locality in error).
Lepeletier, 1835: 189 (w.q.); Smith, 1858a PDF: 101 (m.); Mayr, 1862 PDF: 731 (q.m.); Wheeler & Wheeler, 1952a PDF: 117 (l.).
Combination in Paraponera: Smith, 1858a PDF: 100.
Senior synonym of Paraponera aculeata and material of the unavailable name Paraponera spininoda referred here: Latreille, 1802a: 207; of Paraponera tarsalis: Smith, 1858a PDF: 100.
See also: Brown, 1958g: 205.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Natural History:

This is the famous "bala" ant, reknowned for its large size and powerful sting; workers forage arboreally at all heights in the canopy; nests are subterranean at the bases of trees, or occasionally in humus accumulations in the canopy; workers forage on live prey and extrafloral nectar; males are frequent at blacklights. There is a growing literature of behavioral and ecological studies of Paraponera.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

1. Paraponera clavata HNS . Pl. VII. fig. 6. B.M.

Formica clavata, Fabr. HNS Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.

Formica armata, Oliv. HNS Encycl. Meth. vi. 498. 42.

Formica spininoda, Latr. HNS Hist. Nat. Fourm. 207 [[queen]] [[worker]].

Ponera tarsalis, Perty HNS , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].

Ponera clavata, Erichs HNS . Faun, et Flo. Brit. Guiana, iii. 592.

Hab. South America (Napo); Brazil (Para).

The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 100-101, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

clavata (Fabricius HNS 1775).

Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 38-38, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Throughout the wet Neotropics. Costa Rica: Atlantic slope wet forest, low elevations; extending to just west of Santa Cecilia in northern Guanacaste Province (Janzen, pers. comm.); absent from wet forest of southern Pacific slopes and Osa.

Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Smith, F.:
  Formica clavata, Fabr. Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.
  Formica armata, Oliv. Encycl. Meth. vi. 498. 42.
  Formica spininoda, Latr. Hist. Nat. Fourm. 207 [[queen]] [[worker]].
  Ponera tarsalis, Perty , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].
  Ponera clavata, Erichs . Faun, et Flo. Brit. Guiana, iii. 592.
  Hab. South America (Napo); Brazil (Para).
  The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.
 

Forel, A., 1909:
 — [[ worker ]]. — Cette espece bresilienne porte avec d'autres la fausse etiquette « Guinee »!
 

Wild, A. L., 2007:
 Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amambay (INBP). Literature records: “Paraguay” (s. loc.) (Forel 1895).

License not applicable

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

— [[ worker ]]. — Cette espece bresilienne porte avec d'autres la fausse etiquette « Guinee »!

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Formica clavata, Fabr. Syst. Ent. 394. 18 [[worker]]; Ent. Syst. ii. 360. 44; Syst. Piez. 410. 61.

 

Formica armata, Oliv. Encycl. Meth. vi. 498. 42.

 

Formica spininoda, Latr. Hist. Nat. Fourm. 207 [[queen]] [[worker]].

 

Ponera tarsalis, Perty , Del. An. Art, 135. t. xxxvii. f. 2 [[queen]].

 

Ponera clavata, Erichs . Faun, et Flo. Brit. Guiana, iii. 592.

 

Hab. South America (Napo); Brazil (Para).

 

The male of this species resembles the female in the form of the abdomen and node of the peduncle, they are, however, smoother and more highly polished; all the specimens which I have examined are of a paler colour, being more or less obscurely ferruginous; the head narrower than the thorax, the eyes large and prominent, and the antennae three-fourths of the length of the body.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Paraponera clavata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Paraponera clavata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTTAACAAT---GAGCAAATTTTTAATTCACTCGTTACTAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATAATCGGAGGGTTCGGTAATTTCTTAGTACCATTAATAATTGGAGCTCCTGACATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTGTTACCTCCTTCATTATTTCTACTAACCTTAAGTAATTTAATTAATAATGGAGTAGGTACAGGATGAACCGTATATCCTCCTCTATCATCTAATGTATATCATAGTGGACCATCAGTAGACTTAACTATTTTCTCCTTACATATTGCAGGTATCTCATCAATTTTAGGATCAATTAATTTTATTTCTACAATTTTAAATATACACCATAAAAATTTTAGATTAGATAAAATCCCTCTATTAGTTTGATCCATCTTAATCACCACCATCCTCCTATTATTAGCCTTACCAGTTTTAGCAGGAGCCATCACAATATTATTAACAGATCGAAATTTAAATACATCTTTTTTTGACCCGTCAGGAGGAGGAGACCCCGTATTATACCAACACTTATTTTGATTTTTTGGACACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTTTAATCTCCCATATTATAATAAATGAAAGAGGTAAAAAAGAAACATTTGGGTCACTTGGAATAATTTACGCAATAATAGCTATTGGATTTTTAGGATTTGTTGTGTGAGCCCATCATATATTCACAATTGGATTAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Paraponera clavata

Paraponera clavata is a species of ant, commonly known as the lesser giant hunting ant,[1] conga ant, or bullet ant, named on account of its powerful and potent sting. It inhabits humid lowland rainforests from Nicaragua and the extreme east of Honduras south to Paraguay. The bullet ant is called hormiga veinticuatro or "24 (hour) ant" by the locals, referring to the 24 hours of pain that follow being stung.[2] The species epithet clavata means "club-shaped".

Description[edit]

Worker ants are 18–30 millimetres (0.7–1.2 in) long[3] and resemble stout, reddish-black, wingless wasps. Paraponera is predatory, and like all primitive poneromorphs, does not display polymorphism in the worker caste; the queen ant is not much larger than the workers.[4]

Photograph demonstrating the size of bullet ants, with a 2-cm scale bar
Paraponera clavata – museum specimen

Sting[edit]

The pain caused by this insect's sting is purported to be greater than that of any other hymenopteran, and is ranked as the most painful according to the Schmidt sting pain index, given a "4+" rating, above the tarantula hawk wasp and, according to some victims, equal to being shot, hence the name of the insect. It is described as causing "waves of burning, throbbing, all-consuming pain that continues unabated for up to 24 hours". The ant is thought to have evolved its sting to ward off any predators that would normally unearth them.[2] Poneratoxin, a paralyzing neurotoxic peptide isolated from the venom, affects voltage-dependent sodium ion channels and blocks the synaptic transmission in the central nervous system. It is being investigated for possible medical applications.[5][6]

Initiation rites[edit]

The Satere-Mawe people of Brazil use intentional bullet ant stings as part of their initiation rites to become a warrior.[7] The ants are first rendered unconscious by submerging them in a natural sedative, and then hundreds of them are woven into a glove made of leaves (which resembles a large oven mitt), stingers facing inward. When the ants regain consciousness, a boy slips the glove onto his hand. The goal of this initiation rite is to keep the glove on for a full 10 minutes. When finished, the boy's hand and part of his arm are temporarily paralyzed because of the ant venom, and he may shake uncontrollably for days. The only "protection" provided is a coating of charcoal on the hands, supposedly to confuse the ants and inhibit their stinging. To fully complete the initiation, however, the boys must go through the ordeal a total of 20 times over the course of several months or even years.[8]

Nest distribution[edit]

Colonies consist of several hundred individuals and are usually situated at the bases of trees. Workers forage arboreally in the area directly above the nest for small arthropods and nectar, often as far as the upper canopy; little foraging occurs on the forest floor. Nectar, carried between the mandibles, is the most common food taken back to the nest by foragers. Two studies in Costa Rica and on Barro Colorado Island (BCI) found about four bullet ant nests per hectare of forest. On BCI, the nests were found under 70 species of trees, six species of shrubs, two species of lianas and one species of palm. Nests were most common beneath the canopies of Faramea occidentalis and Trichilia tuberculata, but these trees are also the most abundant in the forest. Nests were present more frequently than would be expected based on the abundance of the trees under Alseis blackiana, Tabernaemontana arborea, Virola sebifera, Guaria guidonia and Oecocarpus mapoura. The large number of nest plants suggests little active selection of nest sites by bullet ants. Small shrubs, however, are underused, probably because they do not provide access to the forest canopy. The study on BCI concluded trees with buttresses and extrafloral nectaries may be selected for by bullet ants.[9]

Parasites[edit]

The small (1.5– to 2.0-mm-long) phorid fly, Apocephalus paraponerae, is a parasite of injured workers of P. clavata, of which the supply is constant because frequent aggressive encounters occur between neighbouring colonies, resulting in maimed workers. They are able to parasitise healthy ants if they are artificially restrained, but this is thought to be rare in practice, as healthy ants are agile and able to repel the flies. Both male and female flies are attracted by the scent of injured ants; the females lay eggs, as well as feed, and the males feed and possibly mate with the females. The flies are attracted to a crushed ant within two to three minutes and 10 or more flies may be attracted to each ant. Each ant can harbour 20 fly larvae. Carl Rettenmeyer observed P. clavata actively trying to attack A. paraponerae when they approached the entrance to their nest.[3][10]

See also[edit]

References[edit]

  1. ^ Charles Leonard Hogue (1993). Latin American insects and entomology. University of California Press. p. 439. ISBN 0-520-07849-7. Retrieved 2010-11-03. 
  2. ^ a b "The Word:Sting pain index". New Scientist No 2617,. 2007-08-18. p. 44. doi:10.1016/S0262-4079(07)62097-1. Retrieved 2010-09-26. 
  3. ^ a b Brown, B. V.; Feener, D. H. (1991). "Behavior and Host Location Cues of Apocephalus paraponerae (Diptera: Phoridae), a Parasitoid of the Giant Tropical Ant, Paraponera clavata (Hymenoptera: Formicidae)". Biotropica 23 (2): 182–187. doi:10.2307/2388304. JSTOR 2388304.  edit
  4. ^ Morgan, Randy C. "Giant Tropical Bullet Ant, Paraponera clavata, Natural History and Captive Management". Sonoran Arthropod Studies Institute. Archived from the original on March 23, 2009. Retrieved June 10, 2014. 
  5. ^ Szolajska, Ewa (June 2004). "Poneratoxin, a neurotoxin from ant venom: Structure and expression in insect cells and construction of a bio-insecticide". European Journal of Biochemistry 271 (11). doi:10.1111/j.1432-1033.2004.04128.x. PMID 15153103. Retrieved June 10, 2014. 
  6. ^ Gerritsen, Vivienne Baillie (September 2001). "Princess Bala's sting". Protein Spotlight. Swiss Institute of Bioinformatics. Retrieved June 10, 2014. 
  7. ^ Backshall, Steve (6 January 2008). "Bitten by the Amazon". London: The Sunday Times. Retrieved 13 July 2013. 
  8. ^ "Initiation With Ants". National Geographic. National Geographic. Retrieved 13 February 2014. 
  9. ^ Belk, M. C.; Black, H. L.; Jorgensen, C. D.; Hubbell, S. P.; Foster, R. B. (1989). "Nest Tree Selectivity by the Tropical Ant, Paraponera clavata". Biotropica (Biotropica, Vol. 21, No. 2) 21 (2): 173–177. doi:10.2307/2388707. JSTOR 2388707.  edit
  10. ^ Shellee Morehead, Jon Seger, Don Feener and Brian Brown. "A cryptic species complex in the ant parasitoid Apocephalus paraponerae (Diptera: Phoridae)". Archived from the original on 2010-04-07. 

Further reading[edit]

  • Bequaert, J.C. (1926). Medical Report of the Hamilton Rice 7th. Expedition to the Amazon. Harvard University Press. pp. 250–253. 
  • Weber, N. A. (1939). The sting of the ant, Paraponera clavata. Science, 89, 127–128.
  • Lattke, JE (2003) - Subfamilia Ponerinae in Introducción a las Hormigas de la Région Neotropical - Von Humboldt Institute, Bogota, Colombia.
  • Breed, M. D.; Bennett, B. (1985). "Mass recruitment to nectar sources inParaponera clavata: A field study". Insectes Sociaux 32 (2): 198. doi:10.1007/BF02224233.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!