Overview

Brief Summary

Introduction

The Red Imported Fire Ant (Solenopsis invicta, Buren) is a native of tropical and subtropical South America that has achieved international notoriety by becoming an enormously successful invasive ant throughout much of the southern United States.  S. invicta is now spreading rapidly in parts of the Caribbean, and new infestations have been detected and exterminated in Arizona, California, Australia, New Zealand, and southern China.  The probability of new invasions is therefore quite high and S. invicta must be considered a potential threat worldwide in all areas where climates are suitable.

Invasive populations of Solenopsis invicta are by no means easy to ignore. They have been linked to a multitude of destructive effects, including stinging humans, agricultural and horticultural damages, and substantial negative impacts on native faunas and floras. This has resulted in social and political pressure on governments to "solve" the fire ant problem.  Government involvement in fire ant research developed first in the United States, which has an 80 year history of Imported Fire Ant infestation, but other governments have more recently begun research and control efforts of their own. 

In the US, federal and state governments have responded primarily by funding research and by developing detection and infestation prevention programs. There have also been expensive and ecologically disasterous attempts to exterminate entire Imported Fire Ant populations.  On the brighter side, over the course of fifty years, federal and state funding agencies have underwritten a plethora of research programs that have examined in detail the behavior, ecology, life-history, genetics, and potential controls for Solenopsis invicta.  As a result, S. invicta has become in some sense the "Drosophila melanogaster"  of the ant world.  We probably know more about its biology than is known for any other species of ant.  Despite this, our ability to control large-scale infestations remains limited.

Creative Commons Attribution 3.0 (CC BY 3.0)

Stefan Cover

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comprehensive Description

Taxonomic History

Solenopsis invicta Buren, 1972 PDF: 9, fig. 2 (w.q.m.) BRAZIL. AntCat AntWiki

Taxonomic history

Junior synonym of Solenopsis wagneri: Bolton, 1995b: 388.
[Trager, 1991 PDF: 173 incorrectly gave Solenopsis wagneri as an unavailable name; the name is available and has priority over Solenopsis invicta, see note under Solenopsis wagneri.].
Solenopsis invicta conserved over Solenopsis wagneri because of usage, in accord with ICZN (1999): Shattuck, Porter & Wojcik, 1999: 27.
See also: Rhoades, 1977: 1; Smith, 1979: 1386.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

An aggressive tramp species, invasive outdoors in warmer climates. Dispersed with tropical plants, and in sod from southern states brought into ILLINOIS.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Solenopsis invicta​, often referred to as the red imported fire ant, or RIFA, is among the world's most infamous, aggressive and widespread invasive ant species. It is capable of causing serious medical, economic and ecologic problems wherever it occurs. The species is called the red imported fire ant because it is red, it was accidentally introduced into to the United States (imported), and the painful stings it inflicts cause a burning sensation (fire ant). In addition to being a nuisance species and a public health concern, RIFA has been documented to harm wildlife, including vertebrates and invertabrates. The species is also considered a pest because of the conspicuous nest mounds they build in the soil of open landscapes such as lawns, parks and agricultural fields. The mounds are known to reduce land values and agricultural productivty. Humans and other vertebrates are most often attacked after inadvertently disturbing a mound, which causes tens to hundreds of worker ants to pour out of their nest in defence. The sting of Solenopsis invicta has venom composed of a biocidal alkaloid, which causes burning pain and the formation of white pustules [1]. The species is native to South America, but has become established in the western and southern United States, the Caribbean, Australia, Taiwan, Hong Kong, and Macau [2], in addition to the southern Chinese provinces of Guangdong, Guangxi, Hunan, Fujian and Jiangxi [3].





References

  1. W. R. Tschinkel, The Fire Ants. Cambridge, MA: Harvard University Press, 2006, p. 744.


  2. M. S. Ascunce et al., Global Invasion History of the Fire Ant Solenopsis invicta”, Science, vol. 331, no. 6020, pp. 1066 - 1068, 2011.


  3. R. Zhang, Y. Li, N. Liu, and S. D. Porter, An overview of the red imported fire ant (Hymenoptera: Formicidae) in Mainland China”, Florida Entomologist, vol. 90, no. 4, pp. 723 - 731, 2007.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

invicta Buren HNS 1972.

Boquerón , Caaguazú , Canindeyú , Central, Guairá , Ñeembucú , Paraguarí , Pte. Hayes (ALWC, LACM). Literature records: Central (Santschi 1923c), “all of Paraguay” (Trager 1991).

  • Wild, A. L. (2007): A catalogue of the ants of Paraguay (Hymenoptera: Formicidae). Zootaxa 1622, 1-55: 36-36, URL:http://www.antbase.org/ants/publications/21367/21367.pdf
Public Domain

Wild, A. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Solenopsis invicta Buren HNS 1972

I [introduced species]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Macroscopic identification of the mounds of red imported fire ants (RIFA, Solenopsis invicta) is typically made by lay residents of Florida while in the midst of a hasty retreat once the mounds are accidentally disturbed and large numbers of irritated stinging red ants emerge to attack the source of the disturbance.S, invicta soil mounds tend to be 46 cm or less in diameter (Cohen 1992). Red fire ant stings usually result in the formation of a white pustule within 24 hours.Positive identification of individual RIFA is aided by confirmation of a red to brown body color, a two-segmented body pedicel ("waist"), a four-toothed mandible, a sting at the tip of the gaster (terminal abdominal segment), and 10-segmented antennae ending in two-segmented clubs (Hedges 1997).
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Distribution

S. invecta is a southern South American species native to Brazil. It was likely introduced to the United States in the 1920s and 1930s and to parts of Australia in the 1970s. The species has also become established in New Zealand, Puerto Rico, and the Virgin islands. S. invecta now infests more than 320 million acres in 12 states in the southeastern U.S. and Puerto Rico. The species has also recently been reported from California and New Mexico (Holway et al. 2002, ARS 2003). S. invicta occurs throughout the entire state of Florida, including all six counties within the India River Lagoon watershed.
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Solenopsis invicta is native to an elongate range in eastern Argentina centered on the Paraguay River [1][2][3]. The core of the range is a region called the Pantanal at the headwaters of the Paraguay River. The Pantanal is an expansive mosaic of flooded savannas and wetlands. Solenopsis invicta was introduced to Mobile, Alabama in the 1930's. The ants are believed to have originated from northeastern Argentina [4] and traveled to Mobile in a cargo ship. The original colonists included several mature colonies or combinations of mature colonies and colony-founding queens, and it is likely that additional immigration events occurred in subsequent years [3]





References

  1. G. E. Allen, W. F. Buren, R. N. Williams, M. de Menezes, and W. H. Whitcomb, The red imported fire ant, Solenopsis invicta; distribution and habitat in Mato Grosso, Brazil”, Annals of the Entomological Society of America, vol. 67, pp. 43-46, 1974.


  2. W. F. Buren, G. E. Allen, W. H. Whitcomb, F. E. Lennartz, and R. N. Williams, Zoogeography of the imported fire ants, Journal of the New York Entomological Society, vol. 82, pp. 113-124, 1974.


  3. W. R. Tschinkel, The Fire Ants. Cambridge, MA: Harvard University Press, 2006, p. 744.


  4. M. C. Mescher, K. G. Ross, D. D. Shoemaker, L. Keller, and M. J. B. Krieger, Distribution of the two social forms of the fire ant Solenopsis invicta (Hymenoptera: Formicidae) in the native South American range”, Annals of the Entomological Society of America, vol. 96, no. 6, pp. 810 - 817, 2003.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paraguay: Boquerón, Caaguazú, Canindeyú, Central, Guairá, Ñeembucú, Paraguarí, Pte. Hayes
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Diagnosis of worker among Antkey species. Worker caste polymorphic. Total length > 2 mm. Head ovoid (minors) to rectangular (majors). Antenna 10-segmented. Antennal club 2-segmented. Antennal scapes not conspicuously short; easily extended beyond eye level. Antennal insertions at least partly covered by frontal lobes; not surrounded by a raised sharp-edged ridge. Antennal scrobe lacking. Posterolateral corners of head unarmed, without spines. Eyes medium to large (greater than 5 facets); distinctly less than half length."" class=""lexicon-term"">head length. Frontal lobes do not obscure face outline between mandible and eye. Anterior margin of clypeus with two lateral teeth and one median tooth. Mandibles triangular. Pronotal spines absent. Propodeum lacking spines or teeth. Petiole with peduncle; "" class=""lexicon-term"">subpetiolar process not developed as a flange or lobe. Color shiny reddish brown.


Solenopsis invicta is easily separated from S. papuana by the polymorphic worker caste, the greater size (TL > 2.0 mm), and by the larger eye (> 5 facets). It is most reliably separated from S. geminata and S. xyloni by the presence of a median tooth between the two lateral teeth on the anterior margin of the clypeus. This character is often difficult to see, and it is best to examine a moderate sample of specimens of different sizes before a confident determination can be made. The species is further distinguished from the North American native, S. xyloni, by the lack of a well-developed subpetiolar process that forms a flange or lobe. Solenopsis invicta hybridizes with S. richteri. The two species are best distinguished by color (S. invicta is reddish brown and S. richteri is brownish black), but S. invicta x richteri is intermediate.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Florida is home to two different species of fire ant. In addition to the ubiquitous non-native red imported fire ant (Solenopsis invicta), Florida is also home to the less frequently encountered native tropical fire ant, S. geminata. Drees (1997) notes that S. geminata mounds can be distinguished by the presence of workers with disproportionately large square heads that are lacking in S. invicta worker ants.A number of other fire ants of genus Solenopsis occur in the United States, including the black imported fire ant, Solenopsis richteri. Introduced to the U.S. in 1918, Solenopsis richteri co-occurs with S. invicta within a portion of its non-native distribution in the U.S. (e.g., Mississippi and western Georgia) and is capable of hybridizing with S. invicta (ARS 2003, Collins and Scheffrahn 2005).There are more than 280 species of Solenopsis worldwide.
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Trophic Strategy

Solenopsis invicta is a predatory ant species whose diet consists primarily of small invertebrates such as insects and spiders, centipedes and millipedes, earthworms, and other similarly sized prey. S. invicta also regularly consumes carrion and are attracted to sugary substances. Food is collected by foraging worker ants who use pheromone trails to direct one another to food sources once they have been located (USDA 1993).
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

No information.Invasion History: The Agricultural research Service reports that red imported fire ants were accidentally introduced into the United States from South America, likely in the late 1920s (ARS 2003). The precise introduction pathway is unknown, but one possibility is that the ants were accidentally transported into the U.S. along with potted live plants.In the absence of their natural predators, competitors and parasites to keep the species in check, RIFA have become five times as abundant in North America as they are in South America. Since the initial introduction of the species, Solenopsis invicta has expanded its range to include a significant portion of the southeastern United States. Potential to Compete With Natives: Fire ants are capable of causing dramatic reductions in the numbers of native ant populations and a variety of ground-nesting animals (ARS 2003). Allen et al. (1995) report negative impacts of S. invicta on populations of northern bobwhite (Colinus virginianus). Possible Economic Consequences of Invasion: RIFA are responsible for extensive crop damage as well as damage to electrical and other equipment. The Agricultural Research Service has estimated the annual costs in terms of damage and population management control at more than $6.5 billion (ARS 2003).S. invicta has been nominated by the Invasive Species Specialist Group (ISSG) as among "100 of the World's Worst" invasive alien species.
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Vinson & Sorenson (1986) report that a mature S. invicta colony can have nearly one-quarter million workers while typical colonies have about one-third as many. These authors also estimate that in the southern U.S. where S. invicta occurs, nearly 100,000 new queens per year can be produced in every acre of infested land.
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Winged reproductive males called alates are produced once a colony is a year old. As many as 4,500 alates join winged reproductive female alates (the new queens) to take part in a mating flight during which the females are fertilized in the air. The males die shortly thereafter and the fertilized females establish new colonies. Six and eight mating flights in the spring and fall months are typical for mature colonies(Vinson and Sorenson 1986, Collins and Scheffrahn, 2005).Newly mated queens will often cluster together in sheltered areas after mating and may cooperate to establish a new colony. Vinson and Sorenson (1986) indicate that multiple-queen S. invicta colonies do occur in some cases, while in other cases all but one queen will die off as the colony matures (Collins and Scheffrahn, 2005).
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

After mating, a female alate will lose its wings and locate a suitable spot for a new colony. After burrowing into the soil and sealing herself into a self-excavated chamber, the young queen will lay an initial clutch of usually 10-15 eggs. These will hatch into the first cohort of sterile female workers in 8-10 days, during which time the queen will have produced on the order of 100 more eggs (Holldobler and Wilson 1990, Collins and Scheffrahn 2005).As with most insects, S. invicta early life history includes both a larval and a pupal stage. Larvae are the immature, wormlike first feeding forms that emerge from the eggs and pupae are subsequent quiescent stage prior to metamorphosis. In S. invicta each of these stages persists for approximately 1-2 weeks, and the initial cohort of worker ants becomes mature 2-4 weeks after hatching. Until this first clutch grows to maturity, the young queen will refrain from laying more eggs. The queen provides nutrition to the first batch of developing young in a number of ways, including the production of non-developmental trophic eggs, regurgitation of energy-rich oil, salivary secretions, and via breakdown of the now-unneeded wing muscles. All of these sources of nutrition are used to provide nutrients to larvae and pupae of this initial clutch (Vinson & Sorenson 1986, Collins and Scheffrahn 2005). Because the young queen can provide only limited nutrition these initial workers are notably smaller when they emerge than are successive cohorts. On emerging, however, this group of workers sets to work foraging for food for the queen and the next generation of larvae.
  • Agricultural Research Service (ARS). 2003. Update: Hot on the trail of fire ants. Published in Agricultural Research Magazine, Vol. 51.
  • Allen C.R., Lutz R.S., and S. Demarais. 1995. Red imported fire ant impacts on northern bobwhite populations. Ecological Applications 5:632-638.
  • Cohen P.R. 1992. Imported fire ant stings: clinical manifestations and treatment. Pediatric Determology 9:44-48.
  • Collins L., and R.H. Scheffrahn. 2005. Red imported fire ant, Solenopsis invicta Buren (Insecta: Hymenoptera: Formicidae: Myrmicinae). UF/IFAS document EENY-195. Published: January 2001. Revised: August 2005.
  • Drees B.M. 1997. We're all on the same team when tracking fire ants. Available online.Hedges S.A.1997. Fire ants. Pp. 531-535 in: D. Moreland (Ed.). Handbook of Pest Control, 8th Ed. (Mallis Handbook and Technical Training Company.
  • Holldobler B., and E.O. Wilson. 1990. The Ants. 165 p. The Belknap Press of Harvard University Press, Cambridge, MA.
  • Holway D.A., Lach L., Suarez A.V., Tsutsui N.D., and T.J Case. 2002. The causes and consequences of ant invasions. Annual Review of Ecology and Systematics 33:181-233.
  • USDA. 1993. Fact sheet for the two species of imported fire ant: red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri. Document FACTS-03 PPQ.
  • Vinson S.B., and A.A. Sorensen. 1986. Imported fire ants: Life history and impact. Texas Department of Agriculture. Department of Entomology, Texas A and M University. College Station, TX.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Solenopsis invicta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Solenopsis invicta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GCAATTTGAGCAGGAATAATTGGATCATCTATAAGAATAATCATCCGATTAGAACTAGGATCTTGTAATTCTCTAATTAATAAT---GATCAAATCTACAACTCCTTAGTTACTAGACACGCTTTTATTATAATTTTTTTTATAGTTATGCCCTTCATAATTGGAGGATTTGGAAATTTCTTAGTGCCCTTAATACTTGGGTCCCCCGATATGGCCTATCCTCGAATAAATAATATAAGATTTTGACTTCTGCCACCTTCTCTAACTCTTTTACTTATCAGAAGATTTATTAACAGAGGAGTAGGAACAGGATGAACTATCTACCCACCATTAGCCTCCAATATTTTTCACAGAGGGGCCTCTATTGATCTATCTATTTTTTCCTTACATATCGCCGGAATATCATCAATTTTAGGAGCTATTAATTTTATTTCTACAATCATTAACATACACCATAAAAATTTTACTATAGATAAAATCCCCCTACTAGTTTGATCTATCCTTATTACAGCCATTCTTCTTTTACTTTCACTCCCAGTTCTTGCAGGAGCTATTACAATATTACTAACTGACCGTAATTTAAACACCTCCTTCTTCGATCCCTCAGGAGGAGGAGATCCCATTCTATACCAACATTTATTCTGATTTTTTGGACATCCAGAAGTTTACATTTTAATCCTCCCCGGATTTGGACTAATCTCCCATATTATTATAAATGAAAGAGGAAAAAAAGAAACTTTCGGATCTTTGGGCATAATTTATGCTATAATCGCTATCGGATTTTTAGGTTTTATTGTTTGGGCACATCACATATTCACTATCGGCCTTGACGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Management

A Plan for Prevention of Establishment of New Ant Species in Hawaii, with Special Attention to the Red Imported Fire Ant (Revised Aug 2007; PDF | 365 KB)


Know Your Farmer Alliance.


Emergency Response Plan for Invasive Ants in the Pacific - Draft 2 (Nov 29, 2008) 
Vanderwoude Consulting Limited (New Zealand).


Fire Ant Management in the Home Lawn
Clemson University (South Carolina).


Fire Ants and Their Management (PDF | 291 KB)
Texas A&M University. Texas Agricultural Extension Service.


Imported Fire Ants - Publications for Control 
University of Tennessee Extension.


Imported Fire Ant Program Manual (Updated Mar 2010; PDF | 2.4 MB)
USDA. APHIS. Plant Protection and Quarantine.


Managing Fire Ants
Texas A&M University. Texas Imported Fire ant Research and Management Project.


Managing Imported Red Fire Ants in Agriculture: A Regional Publication Developed for: Alabama, Arkansas, Georgia, Louisiana, Texas (PDF | 386 KB)
University of Tennessee. Agricultural Extension Service.


Managing Imported Fire Ants in Urban Areas (PDF | 4 MB) 
Texas A&M University. Texas Agricultural Extension Service.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Antkey

Source: Antkey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red imported fire ant

The red imported fire ant (Solenopsis invicta), or simply RIFA, is one of over 280 species in the widespread genus Solenopsis. Although the red imported fire ant is native to South America,[2] it has become a pest in the southern United States,[2] Australia,[2] the Caribbean,[2] Thailand, Taiwan,[2] the Philippines, Hong Kong,[2] the southern Chinese provinces of Guangdong,[3] Guangxi and Fujian, and Macau,[2] RIFAs are known to give a painful, persistently irritating sting that often leaves a pustule on the skin.[4]

Overview[edit]

The red imported fire ant, a eusocial species, are far more aggressive than most ant species. Animals, including humans, often encounter them by inadvertently stepping on one of their mounds, which causes the ants to swarm up the legs, attacking en masse. The ants respond to pheromones released by the first ant that attacks, thereafter stinging in concert.

RIFAs successfully compete against other ants, and have been expanding their range. Recently, colonies of Rasberry crazy ant (also known as Old World crazy ants) have been introduced in the same ranges as RIFAs. These ants are ecologically dominant over fire ants, which has been limiting their range slightly.[5]

They are considered to be a pest, not only because of the physical pain they can inflict, but also because their mound-building activity can damage plant roots, lead to loss of crops, and interfere with mechanical cultivation. It is not uncommon for several fire ant mounds to appear suddenly in a suburban yard or a farmer's field, seemingly overnight. The sting of the RIFA has venom composed of a necrotizing alkaloid, which causes both pain and the formation of white pustules that appear one day after the sting.

Fire ants are excellent natural predators and can be used as biological controls for pests such as sugarcane borers, rice stink bugs, striped earwigs, aphids, boll weevils, soybean loopers, cotton leafworms, hornflies, and many other pests harmful to crops. However, they also kill beneficial pollinators, such as ground-nesting bee species. Seeds, fruits, leaves, roots, bark, nectar, sap, fungi, and carrion are all fire ant food. They are proficient enough at overwhelming intruders, they can virtually clear an area of invertebrates, lizards, and ground-dwelling birds.

Red imported fire ants are extremely resilient, and have adapted to contend with both flooding and drought conditions. If the ants sense increased water levels in their nests, they come together and form a ball or raft that floats, with the workers on the outside and the queen inside.[6][7] Once the ball hits a tree or other stationary object, the ants swarm onto it and wait for the water levels to recede. To contend with drought conditions, their nest structure includes a network of underground foraging tunnels that extends down to the water table. Also, although they do not hibernate during the winter, colonies can survive temperatures as low as 16 °F (−9 °C).

RIFAs were the first species shown to possess a green-beard gene,[8] by which natural selection can favor altruistic behavior.

Morphology[edit]

Red imported fire ants have both a pedicel and postpediole. In other words, they belong to a group of ants that have two humps between the thorax and abdomen. The workers have 10 antennal segments terminating in a two-segmented club. It is often difficult to distinguish between Solenopsis invicta and some other species in the genus. Characteristic differences are not always consistent between the black imported fire ant (Solenopsis richteri) or hybrids between the two species. In fact, positive identifications can often only be made using high performance liquid chromatography to show differences in cuticular hydrocarbons.

Physiology[edit]

Like other insects, S. invicta breathes through a system of gas-filled tubes called tracheae connected to the external environment through spiracles. The terminal tracheal branches (tracheoles) make direct contact with internal organs and tissue. The transport of oxygen to cells (and carbon dioxide out of cells) occurs through diffusion of gasses between the tracheoles and the surrounding tissue and is assisted by discontinuous gas exchange.[9] As with other insects, the direct communication between the tracheal system and tissues eliminates the need for a circulating fluid network to transport O2.[10] Thus, S. invicta and other arthropods can have a modest circulatory system though they have highly expensive metabolic demands.[11]

S. invicta faces many respiratory challenges due to its highly variable environment, which can cause increased desiccation, hypoxia, and hypercapnia. Hot, humid climates cause an increase in heart rate and respiration which increases energy and water loss.[10][12] Hypoxia and hypercapnia can result from S. invicta colonies living in poorly ventilated thermoregulatory mounds and underground nests. Discontinuous gas exchange (DGE) may allow ants to survive the hypercapnic and hypoxic conditions frequently found in their burrows;[9] it is ideal for adapting with these conditions because it allows the ants to increase the period of O2 intake and CO2 expulsion independently through spiracle manipulation.

Metabolic rate, which indirectly affects respiration, is also influenced by environmental temperature. Peak metabolism occurs at about 32 °C.[13] Metabolism, and therefore respiration rate, increases consistently as temperature increases. DGE stops above 25 °C, although the reason for this is currently unknown.[14]

Respiration rate also appears to be significantly influenced by caste. Males show a considerably higher rate of respiration than females and workers, due, in part, to their capability for flight and higher muscle mass. In general, males have more muscle and less fat, resulting in a higher metabolic O2 demand.[14] While metabolic rate is highest at 32 °C, colonies often thrive at slightly cooler temperatures (around 25 °C). The high rate of metabolic activity associated with warmer temperatures is a limiting factor on colony growth because the need for food consumption is also increased. As a result, larger colonies tend to be found in cooler conditions because the metabolic demands required to sustain a colony are also decreased.[13]

Nest social structure[edit]

Sex ratios[edit]

Several studies have been conducted on the sex ratios exhibited within colonies of S. invicta. More specifically, the queen was seen to actually control the sex ratios. In an experiment, 24 field colonies were selected with highly biased sex ratios in a monogyne population. Eleven of these colonies were male specialists (numerical proportion of males, range: .77 to 1.0), and 13 were female specialists (numerical proportion of males, range: 0.0 to .09). After exchanging queens, 22 of the 24 colonies accepted the foreign queen, and 21 of these colonies produced a new batch of offspring five weeks later.[15]

Based on the colony from which the queen was originated, the sex ratios of the new colony after the switch could be predicted.[16] For example, after switching, a colony produced predominantly males if the queen came from a male-producing colony, even if the host colony originally produced mainly females. It is not surprising, then, queens that came from a male-favored sex ratio colony produced no significant change in the sex-ratio of another male-favored colony after the switch. The same was true for a queen that came from a female-favored sex ratio colony and switched into another female-favored colony.[15] Therefore, the queen determines the sex ratio, not the workers.

Production of sexuals[edit]

Another study compared the inhibition of the number of sexuals (male and female) produced in a single queen colony and a queenless colony. Freshly killed corpses of functional (egg-laying) queens were added daily to queenless colonies. These effectively inhibited the production of sexuals through the excretion of pheromones, although not as effectively as living queens. Conversely, corpses of queens not laying eggs did not inhibit the production of sexuals when added to queenless colonies. Also, when queens were introduced into queenless colonies that already had developed sexual larvae, workers in the colony executed these larvae. This indicates the queen’s control over the production of sexuals can be enforced retroactively, even after the larvae are sexualized. These results provide evidence that functional queens exert control over the production of sexuals in S. invicta through pheromones that influence the behaviors of workers toward both male and female larvae.[17]

Polygyne colonies[edit]

S. invicta also presents a paradox for kin selection theory. In multiple-queen (polygyne) colonies, the egg-laying queens are, on average, unrelated to one another, so the workers appear to raise new sexuals that are no more closely related to them than are random individuals in a population. This was tested by removing worker/queen pairs engaged in trophallaxis with forceps, and then sampling the allele frequency to estimate for the reference population. Frequencies of the most common allele at each locus have been found to conform to Hardy-Weinberg expectations in past studies. Genotypic data were used to estimate relatedness between the workers and the winged-queens they tended, and it was virtually zero. The results indicate S. invicta workers tending queens in polygyne nests do so without respect to the relatedness of those queens.[16][18]

Nest founding[edit]

Fire ant mound

Unrelated queens commonly found a colony cooperatively. This joint effort of the cofoundresses contributes to the growth and survival of the incipient colony.[19] However, such associations are not always stable. The emergence of the first workers instigates queen-queen and queen-worker fighting. The two factors that could affect the survival of individual queens are their relative fighting capabilities and their relative contribution to worker production. Experimentation indicates that size, an indicator of fighting capacity, positively correlates with survival rates. However, manipulation of the queen’s relative contribution to worker production had no correlation with survival rate. It can be assumed that the worker brood cannot favor its mother based on these results.[20]

S. invicta workers not only tend to queens indiscriminately, but they also indiscriminately attack them. Queens producing diploid males reared fewer offspring, but were as likely to survive as queens producing only workers. It would have been assumed that if workers controlled queen mortality, they would be expected to discriminate in favor of their mother, therefore increasing their inclusive fitness. This, however, should favor the queen with the greatest number of daughters during the period of queen execution. The data actually show the fights among queens themselves have a strong role in determining which queen survives—the heavier cofoundress was more likely to win. Thus, queen survival is enhanced by high fighting ability relative to cofoundresses, rather than by the number of offspring she has. Workers respond to these queen differences by attacking the previously injured queen to reinforce the effects of competition among the queens.[21]

Behavior[edit]

Green beard altruism[edit]

Concept[edit]

W.D. Hamilton (1964) proposed the hypothetical idea that organisms may have certain 'recognition alleles' that are phenotypically observable. Richard Dawkins (1976) later named this concept the ‘green-beard effect’. Amongst certain species, such a gene imparts three elements upon the bearer: it causes the bearer to present an observable and unique trait; it enables the bearer to distinguish between individuals that do and do not display this characteristic; and it leads the bearer to act altruistically toward those that exhibit the trait.[22] Today, there is evidence that a greenbeard gene exists in the fire ant.[22]

Discovery in S. invicta[edit]

Keller and Ross (1998) discovered the green beard gene in S.invicta at the Gp-9 locus. In their study, they provided an explanation of the deaths of queens that were homozygous dominant at this locus (BB). In multiple-queen colonies, the heterozygous Bb workers execute the homozygous BB queens, initiating reproduction. A red fire ant’s genomic identity at the Gp-9 locus causes Bb workers to kill the queens that are not Bb.[23] These executions are correlated with an odor cue that workers used to differentiate between BB and Bb queens. While this does not ideally represent the classical green-beard principles, where green-beard wearers kill nonwearers, this mechanism of selection is comparable. The Gp-9 locus may be linked to maintaining monogyny and polygyny and genetic separation of the subpopulation.[24] Each BB queen remained alive when it lived in a small colony fragment of a few hundred workers; she was only executed once she returned to the main polygynous colony that already had queens. Workers thereby will only tolerate a BB queen in a colony in which she is the only queen.[23][24]

Recent findings[edit]

Wang et al. (2013) expanded upon earlier findings, characterizing the genomic region responsible for the fire ants’ social polymorphism; they found that this region is “part of a pair of heteromorphic chromosomes that have many of the key properties of sex chromosomes".[25] Using restriction-site-associated DNA (RAD) tag sequencing, the researchers found that the Sb chromosome only occurs in one type of social organization, similar to the “selection regimen” in Y and W chromosomes. The Sb chromosome includes “a large non-recombining region, inversions, an increased amount of repetitive elements, and deleterious mutations, resulting in Sb/Sb individuals being non-viable".[25] The various genes within the larger supergene provide integrated control to maintain the phenotypes that Keller and Ross originally described above. The Gp-9 system is a subsidiary arrangement that emerged after “the evolution of polygyny, and long after eusociality”.[26]

Necrophoric behavior[edit]

Necrophoric behavior refers to the disposal of corpses. In many species of ants, workers discard uneaten food and other such wastes in a refuse pile.[27] Pioneering work was undertaken by Wilson (1958), who studied the impetus behind corpse disposal in worker ants, Pogonomyrmex badius Latreille. Filter paper squares treated with acetone extracts of P. badius corpses were carried to the refuse pile in the same manner as corpses. The active component was not identified, but the fatty acids accumulating as a result of decomposition were implicated and bits of paper coated with synthetic oleic acid typically elicited a necrophoric response. The process behind this behavior in imported red fire ants was confirmed by Blum (1970): unsaturated fats, such as oleic acid, elicit corpse removal behavior.[28] Freshly frozen RIFA workers were not treated like corpses by their nest mates and were not carried away since there was no decomposition and therefore no accumulation of fatty acids. Furthermore, after healthy workers received a light application of oleic acid and were returned to their nest, workers encountering the treated ants quickly seized them and transported them to the refuse pile.[29]

Social factors[edit]

Social factors can affect an animal’s response to a chemical cue. Gordon, examining the effect of social context on the response of ant colonies to oleic acid,[30] found that colonies responded to oleic acid differently in different social contexts, carrying objects to the midden only in certain situations. When a large majority of ants (greater than 15%) are doing midden work or nest maintenance, treated objects were taken to the midden. However, if the majority of the ants were foraging or convening, treated objects were taken to the nest. The colonies respond to oleic acid by quickly relocating the treated object to destinations that are appropriate for their current activities. If a plurality of the colony’s work force is participating in an activity, a worker encountering the treated paper likely is engaging in that activity. Thus, if most ants are participating in midden work, the paper encountered by a midden worker likely will be carried to the midden. However, if a large percentage of the ants outside the nest are feeding or are part of a group being recruited to a food source, a forager will probably discover the treated object and carry it into the nest as food. The response to oleic acid depends on colony activities at the time treated objects are encountered.[31]

Behavioral theory on invasive species[edit]

This area of study distinguishes between behavioral factors influencing different facets of invasion success, such as colonization, establishment, and spread, to determine which behaviors are responsible for the effectiveness of some invasive species. For example, high dispersal ability, omnivory, gregariousness, and asexuality enhance the probability of colonization and establishment, but these behaviors do not influence a species' competitive ability or its subsequent spread.[32]

Queen recruitment[edit]

Solenopsis queens and workers

Polygynous colonies differ substantially from monogynous colonies in social insects. The former experience reductions in queen fecundity, dispersal, longevity, and nestmate relatedness.[33] Understanding the mechanisms behind queen recruitment is integral to understanding how these differences in fitness are formed. It is unusual that the number of older queens in the colony does not influence new queen recruitment. Levels of queen pheromone, which appears to be related to queen number, play important roles in regulation of reproduction. It would follow that workers would reject new queens when exposed to large quantities of this queen pheromone. Moreover, experimental data support the claim that queens in both populations enter nests at random, without any regard for the number of older queens present.[34] There is no correlation between the number of older queens and the number of newly recruited queens. Three hypotheses have been posited to explain the acceptance of multiple queens into established colonies: mutualism, kin selection, and parasitism.[35] The mutualism hypothesis states that cooperation leads to an increase in the personal fitness of older queens. However, this hypothesis is not consistent with the fact that increasing queen number decreases both queen production and queen longevity.[36] Kin selection also seems unlikely given that queens have been observed to cooperate under circumstances where the queens are statistically unrelated.[37] Therefore, queens experience no gain in personal fitness by allowing new queens into the colony. Parasitism of preexisting nests appears to be the best explanation of polygyny. One theory is that so many queens attempt to enter the colony that the workers get confused and inadvertently allow several queens to join the colony.

Monogyny and polygyny[edit]

Recognition[edit]

Recognition between conspecifics is an essential attribute of ant social behavior for repelling non-nestmates and protecting food resources. RIFAs use olfactory cues produced by queens to discriminate between colony members and conspecific intruders. They also use environmentally derived cues to discriminate between colony members and nonmembers. RIFAs have two distinct forms of colony organization: monogyny and polygyny, distinguishable by the number of reproductive queens, how reproduction is divided among members of the colony, the number of individuals produced, the degree of genetic relatedness, and queens' and workers' behaviors. Different behaviors are correlated with allelic differences at the nuclear gene general protein-9 (Gp-9) that codes for two groups of odor-binding proteins. Queens of monogyne colonies possess B-like alleles (with BB genotype) and are more prolific, heavier, and longer-lived than queens of polygyne colonies. In Argentina, polygyne colonies can be heterozygous (Bb) or homozygous (BB), thus some polygyne workers present b-like alleles.

Behavioral discrimination between conspecifics[edit]

Monogyne workers kill foreign queens and aggressively defend their territory. However, not all behaviors are universal, primarily because worker behaviors depend on the ecological context in which they develop, and the manipulation of worker genotypes can elicit change in behaviors. Therefore, behaviors of native populations can differ from those of introduced populations.[38] In a study to assess the aggressive behavior of monogyne and polygyne red fire ant workers by studying interaction in neutral arenas, and to develop a reliable ethogram for readily distinguishing between monogyne and polygyne colonies of RIFAs in the field,[39] monogyne and polygyne workers discriminated between nestmates and foreigners as indicated by different behaviors ranging from tolerance to aggression. Monogyne ants always attacked foreign ants independently if they were from monogyne or polygyne colonies, whereas polygyne ants recognized, but did not attack, foreign polygyne ants, mainly by exhibiting postures similar to behaviors assumed after attacks by Pseudacteon phorids. Hostile versus warning behaviors were strongly dependent on the social structure of workers. Therefore, the behavior toward foreign workers was a reliable ethological indicator to characterize monogyne and polygyne colonies of RIFAs.[40]

The monogynous red imported fire ant colony’s territorial area and the mound size are positively correlated, which, in turn, is regulated by the colony’s size (number and biomass of workers), distance from neighboring colonies, prey density, and by the colony's collective competitive ability. In contrast, nestmate discrimination among polygynous colonies is more relaxed as workers tolerate conspecific ants alien to the colony, accept other heterozygote queens, and do not aggressively protect their territory from polygyne conspecifics.[41] These colonies might increase their reproductive output as a result of having many queens and the possibility of exploiting greater territories by means of cooperative recruitment and interconnected mounds.[42] Therefore, polygyne workers displayed low aggressive responses toward polygyne non-nestmates because lower aggression results in higher survival. Consequently, the behavior of workers is another reliable factor to characterize both monogyne and polygyne colonies of red imported fire ant, in addition to considering mean worker sizes, density or distance between mounds, number of queens, or molecular assays.

Economic impact[edit]

Australia[edit]

An outbreak of the RIFAs in Queensland, Australia, was discovered on 22 February 2001. The ants were believed to be present in shipping containers arriving at the Port of Brisbane from the United States. Anecdotal evidence suggests fire ants may have been present in Australia for six to eight years prior to formal identification. While the outbreak is restricted to a small (800-km2) region of southeast Queensland in and around Brisbane, the potential social, economic, and ecological damage prompted the Australian government to respond rapidly. The initial emergency response was followed by the formation of the Fire Ant Control Centre in September 2001. Joint state and federal funding of A$175 million was granted for a six-year eradication program involving the employment of more than 600 staff and the broad-scale baiting of about 678.9 km2 between eight and 12 times, followed by two years of surveillance. Following the completion of the fourth year of the eradication program, the Fire Ant Control Centre estimated eradication rates of greater than 99% from previously infested properties. The federal budget confirmed the program will receive extended Commonwealth funding of around A$10 million for at least another two years, until June 2009, to treat the residual infestations found most recently, and to fund validation of the overall treatment and surveillance program.[43] As in previous years, the states have agreed in principle to match the federal funding. That decision is set to be ratified in June 2007.[dated info]

Hong Kong[edit]

According to a press briefing of the Agriculture, Fisheries and Conservation Department of Hong Kong, the territory's authorities have also located several ant-hills of Solenopsis invicta in an artificial wetland in Hong Kong's northwestern section.[citation needed]

People's Republic of China[edit]

In the People's Republic of China in January 2005, a controversy arose when it became known that Guangdong's provincial government had suppressed all information about the spread of fire ants in the province since the middle of 2004. Newspapers in neighbouring Hong Kong, including Apple Daily, Ming Pao, Hong Kong Economic Times, Sing Tao Daily , and Takungpao (the latter funded by the Chinese government), have also reported the ants have been found in both Shenzhen and Wuchuan in Guangdong province.[citation needed]

Philippines[edit]

Colonies have been reported in metro Manila and the Province of Cavite in the Philippines since July 2005; however, since early 2007, they have spread now as far as the Bicol Region.[citation needed] Reports from the Philippines, however, have not been confirmed and are likely to be misidentification of the tropical fire ant (Solenopsis geminata).[44]

Taiwan[edit]

Since September 2004, Taiwan has been seriously affected by the red fire ant.[citation needed] A few people are reported to have succumbed to venom from the ant stings.[citation needed] A large campaign to kill the ants has been partially effective, but it has not been able to eliminate all of them.

United States[edit]

A queen red fire ant, slightly crushed during scanning

The Food and Drug Administration (FDA) estimates more than US$5 billion are spent annually on medical treatment, damage, and control in RIFA-infested areas. Further, the ants cause about US$750 million in damage to agricultural assets, including veterinary bills and livestock loss, as well as crop loss.[45]

Countermeasures[edit]

Many scientists and agencies are attempting to develop methods to stop the spread of the RIFA. Typically, control has been achieved through pesticide use. From the 1950s into the 1970s, Mirex was extensively used in an attempt to eradicate the species. However, the pesticide inadvertently aided the fire ants' spread by killing numerous native ant species that compete successfully with them.[46] Mirex also caused even broader ecological harm that was often attributed to the fire ants. For example, it was first thought that the ants were linked to the decline of overwintering birds (e.g. the loggerhead shrike), but a later study showed the pesticides were largely to blame.[47] RIFAs have virtually no natural biological control agents native to, or naturalized in, the United States, China, the Philippines, or Australia. Current research is focused on introducing biological control agents from the RIFA's native range.

Biological methods[edit]

The microsporidian protozoan Thelohania solenopsae and the fungus Beauveria bassiana are promising pathogens. Solenopsis daguerrei, a parasitic ant, invades RIFA colonies to replace the queen in hopes of gaining control of the colony. For this reason, its use as a biological control agent is also being explored.

Pseudacteon tricuspis and Pseudacteon curvatus are parasitoid phorid flies from South America which parasitize the ants. The female flies each lay an egg at the junction of head and thorax of their victims, prompting a jerky dance manoeuvre by the ants. The larva then slowly consumes the contents of the head, decapitating the ant in the process, and uses the exoskeleton as a pupal case.

Phorid flies have been introduced in many places in southeastern United States, and are slowly reproducing and spreading to cover the entire RIFA range. The amount of actual damage done to the ants by phorid flies is minimal, but the ants appear to be aware of the hovering flies, losing their social organization and ceasing foraging. In addition, phorid flies are very species-specific, and should, in theory, leave native ant species (the fire ants' prime competitors) unmolested.

Scientists at the US Agricultural Research Service also have been able to infect phorid flies with Kneallhazia solenopsae, a spore-producing insect pathogen, to control the population of RIFAs.[48] The flies are unharmed by the pathogen and serve as vectors in transmitting the disease to the ants. The pathogen is able to reduce colonies by 53-100%, and may serve as an effective biological control for the ants.[49]

A virus, SINV-1,[50] has been found in about 20% of fire ant fields, where it appears to cause the slow death of infected colonies. It has proven to be self-sustaining and transmissible. Once introduced, it can eliminate a colony within three months. Researchers[51] believe the virus has potential as a viable biopesticide to control fire ants.[52]

In some cases, hastily adopted biological control agents can do more harm than good (such as the western mosquitofish in Australia), and it remains to be seen how much success biological control of the RIFA will have.

Physical methods[edit]

Researchers have also been experimenting with extreme temperature change to exterminate RIFAs, such as injecting liquid nitrogen or pressurized steam into RIFA nests. Besides using hot steam, pouring boiling water into ant mounds has been found effective in exterminating their nests.[53] Folk remedies have often sought a rapid increase in temperature by soaking the nest in gasoline or kerosene and lighting it on fire, though this is potentially dangerous. Further, the burning of the nest is ineffective due the tendency of queens to be several feet underground. This confusion stems from the observation that fuel vapor has a near instantaneous lethal effect on the ants.[citation needed]

In Brisbane, Australia, colonies are being eradicated or effectively controlled by ground baiting with food laced with contraceptives that render the colony's queen infertile, and toxicants. Mass baiting was undertaken following detection of the ants around the port of Brisbane and in southwestern Brisbane in 2001. Widespread public reporting of suspect colonies (by sending in samples of ants for identification) allowed mapping of the ant's locations. This was combined with satellite imagery to determine the vegetated habitats most likely to be infiltrated by the ants, and the baits were targeted in these areas. Known infested areas were declared high-risk restricted areas, and any material being moved from these areas which could harbour ants (soil, mulch, potted plants, potting mix, hay bales, construction machinery, etc.) had to be inspected prior to disposal or movement, and bulk waste sent to transfer stations for examination, treatment, and disposal. The infestation was initially thought to cover 270 km2, with a density of up to 600,000 colonies/km2 on highly infested sites. As program activity refined data on the infested area, overall size grew to around 80,000 ha by 2006/7. At mid-2007 in the ongoing nationally funded eradication campaign, fewer than 100 active colonies were located in the entire South-East Queensland area between September 2006 and February 2007. The focus of delivering eradication has now switched largely to surveillance, while control and validation measures are expected to continue until 2009. The six-year eradication campaign has cost A$175 million to date, and had secured funding in principle for a minimum of two more years.[54][55]

Genomics[edit]

A fire ant genome was sequenced in 2010.[56] This creates new opportunities for research on fire ant behavior, and offers new opportunities for directed control measures that minimize environmental impact. The sequence can be searched and downloaded at antgenomes.org.

See also[edit]

Notes[edit]

  1. ^ The species was first described as Solenopsis saevissima wagneri (a variety of Solenopsis saevissima) by Santschi (1916). Creighton (1930) reclassified the taxon as Solenopsis saevissima electra var. wagneri (infrasubspecific); Wilson (1952) placed the taxon as a junior synonym of S. saevissima saevissima. In 1972, Buren described what he thought was a new species, Solenopsis invicta. Trager (1991) synonymized both taxa; incorrectly citing Solenopsis saevissima electra wagneri as the original name, he erroneously believed that the name Solenopsis wagneri was unavailable, and used Buren's name Solenopsis invicta. To avoid confusion, ICZN decided to conserve the now widely used name Solenopsis invicta, despite that Solenopsis wagneri had priority.[1]

References[edit]

  1. ^ Shattuck, S. O.; Porter, S. D.; Wojcik, D. P. (1999). "Case 3069. Solenopsis invicta Buren, 1972 (Insecta, Hymenoptera): proposed conservation of the specific name.". Bulletin of Zoological Nomenclature 56 (1): 27–30. 
  2. ^ a b c d e f g M. S. Ascunce et al., “Global Invasion History of the Fire Ant Solenopsis invicta”, Science, vol. 331, no. 6020, pp. 1066 - 1068, 2011. - See more at: http://www.sciencemag.org/content/331/6020/1066.short
  3. ^ Z. Ling, L. YongYue, H. XiaoFang, Z. WeiQiu, and L. GuangWen, “Identification of red imported fire ant, Solenopsis invicta, to invade mainland China and infestation in Wuchuan, Guangdong”, Chinese Bulletin of Entomology, vol. 42, pp. 144–148, 2005.
  4. ^ "Red imported fire ant, Solenopsis invicta Buren". UF/IFAS Featured Creatures. 
  5. ^ Oppenheimer, Daniel; LeBrun, Edward G. (May 16, 2013). "Invasive Crazy Ants Are Displacing Fire Ants, Researchers Find". University of Texas, Austin. 
  6. ^ Flatow, Ira (April 29, 2011). Bug News Roundup: Ant Rafts, Robot Caterpillars (video) Science Friday. NPR. Retrieved 9 May 2011.
  7. ^ Mlot, Nathan J.; Craig A. Tovey; David L. Hu (April 25, 2011). "Fire ants self-assemble into waterproof rafts to survive floods". Proceedings of the National Academy of Sciences. doi:10.1073/pnas.1016658108. Retrieved 9 May 2011. 
  8. ^ Keller, Laurent; Ross, Kenneth G. (1998). "Selfish genes: a green beard in the red fire ant" (PDF). Nature 394 (6693): 573–575. doi:10.1038/29064. 
  9. ^ a b Vogt, J.T., Appel, A.G. 2000. Discontinuous gas exchange in the fire ant, Solenopsos invicta Buren: Caste differences and temperature effects. Journal of Insect Physiology 46, 403-416.
  10. ^ a b Klowden, M.J. 2007. Physiological systems in insects, 2nd Ed. Elsevier/Academic Press, Amsterdam; Boston, pp 357-383 and 433-449.
  11. ^ Hill, R.W., Wyse, G.A., Anderson, M. 2012. Animal physiology, 3rd Ed. Sinauer Associates, Sunderland; Massachusetts, pp 612-614.
  12. ^ Elzen, G.W. 1986. Oxygen consumption and water loss in the imported fire ant Solenopsis invicta Buren. Comparative Biochemistry and Physiology 84, 13¬‐17.
  13. ^ a b Porter, S.D., Tschinkel, W.R. 1993. Fire ant thermal preferences: Behavioural control of growth and metabolism. Behavioural Ecology and Sociobiology 32, 321-329.
  14. ^ a b Vogt, J.T., Appel, A.G. 1999. Standard metabolic rate of the fire ant, Solenopsos invicta Buren: Effects of temperature, mass, and caste. Journal of Insect Physiology 45, 655-666.
  15. ^ a b Passera, Luc, S. Aron, E.L. Vargo, and L. Keller. "Queen Control of Sex Ratio in Fire Ants." Sciencemag (2001): 1308
  16. ^ a b Davies, N.B., Krebs, J.R., and West, S.A. An Introduction to Behavioural Ecology. 4th ed. West Sussex: Wiley-Blackwell, 2012. Pg. 385.
  17. ^ Vargo, E.L., Fletcher, David J.C. "Evidence of pheromonal queen control over the production of male and female sexuals in the fire ant, Solenopsis invicta" Journal of Comparative Physiology A. Volume 159, Issue 6, pp. 741-749.
  18. ^ DeHeer, C.J. and Ross, K.G. "Lack of Detectable Nepotism in Multiple-Queen Colonies of the Fire Ant Solenopsis invicta (Hymenoptera: Formicidae)." Behavior Ecology and Sociobiology. Volume 40, Number 1 (1997), pp 27-33.
  19. ^ http://beheco.oxfordjournals.org/content/10/4/428.abstract
  20. ^ http://rspb.royalsocietypublishing.org/content/263/1369/509.short
  21. ^ Balas, M.T., Adams, E.S. "The dissolution of cooperative groups: mechanisms of queen mortality in incipient fire ant colonies." Behavioral Ecology and Sociobiology. Volume 38, Number 6 (1996). pp 391-399.
  22. ^ a b Krebs, J. R., Nicholas B. Davies, and Stuart A.West. An Introduction to Behavioral Ecology. Oxford: Blackwell Scientific Publications, 1989. Print.
  23. ^ a b Keller, Laurent, and Kenneth G. Ross. "SelfishGenes: A Green Beard in the Fire Ant." Nature.com. NaturePublishing Group, 6 Aug. 1998. Web. 17 Sept. 2013.
  24. ^ a b Grafen, Alan. "Green Beard as Death Warrant." Nature 394 (1998): 521-23. Print.
  25. ^ a b Wang, John, Yannick Wurm, MingkwanNipitwattanaphon, Oksana Riba-Grognuz, Yu-Ching Huang, DeWayne Shoemaker, andLaurent Keller. "A Y-like Social Chromosome Causes Alternative ColonyOrganization in Fire Ants." Nature 493 (2013): 664-68. Print.
  26. ^ Bourke, Andrew F.G. "Genetics: A SocialRearrangement--Genes and Queens." Nature (2013): 612. NaturePublishing Group, 31 Jan. 2013. Web.
  27. ^ http://archive.org/stream/lifeoftheantbyma015682mbp#page/n0/mode/2up
  28. ^ http://www.jstor.org/stable/4533717
  29. ^ http://psyche.entclub.org/65/65-108.html
  30. ^ http://link.springer.com/article/10.1007/BF00987774
  31. ^ http://www.sciencedirect.com/science/article/pii/0003347262901434
  32. ^ http://www.sciencedirect.com/science/article/pii/S0169534799016365
  33. ^ http://www.jstor.org/stable/2411311
  34. ^ http://www.jstor.org/stable/2096904
  35. ^ http://www.jstor.org/stable/10.1086/303205
  36. ^ http://dx.doi.org/10.1016/S0169-5347(00)89133-8
  37. ^ http://www.jstor.org/stable/2462750
  38. ^ http://dx.doi.org/10.1007/s10530-006-9059-8
  39. ^ http://dx.doi.org/10.1007/s002650050568
  40. ^ “Behavioral Discrimination Between Monogyne and Polygyne Red Fire Ants (Hymenoptera: Formicidae) in Their Native Range."
  41. ^ Relationship of queen number and queen relatedness in multiple-queen colonies of the fire ant Solenopsis invicta
  42. ^ Mechanisms of population regulation in the fire ant Solenopsis invicta: an experimental study. Journal of Animal Ecology
  43. ^ http://www.maff.gov.au/releases/07B010.html
  44. ^ Wetterer, James K. (2013). "Exotic spread of Solenopsis invicta (Hymenoptera: Formicidae) beyond North America". Sociobiology 60: 53–63. 
  45. ^ McDonald, Maggie (February 2006). "Reds Under Your Feet (interview with Robert Vander Meer)". New Scientist 189 (2538): 50. 
  46. ^ Theodoropoulos, D. 2003. Invasion Biology. Avaar Books, Blythe, CA
  47. ^ Yosef, R and FE Lohrer. 1995. Loggerhead shrikes, fire ants and red herrings? Condor 97:1053-1056
  48. ^ [1]
  49. ^ "ARS Parasite Collections Assist Research and Diagnoses". USDA Agricultural Research Service. January 28, 2010. 
  50. ^ Steven M. Vallesa, Charles A. Strong, Phat M. Dang, Wayne B. Hunter, Roberto M. Pereira, David H. Oi, Alexandra M. Shapiro, David F. Williams (2004-07-09). "A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization". Virology 328 (1): 151–157. doi:10.1016/j.virol.2004.07.016. PMID 15380366. 
  51. ^ "Integrated management of imported fire ants and emerging urban pest problems". United States Department of Agriculture. May 17, 2007. 
  52. ^ "Fire ants may have met their match". CNN. May 7, 2007. Archived from the original on May 13, 2007. 
  53. ^ Nature & Science » Biology Resources » Integrated Pest Management Manual
  54. ^ Catalyst: Fire Ant update - ABC TV Science
  55. ^ http://www.dpi.qld.gov.au/cps/rde/dpi/hs.xsl/4790_4551_ENA_HTML.htm
  56. ^ Fire ant genome
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!