Overview

Brief Summary

Introduction

D. gigas is the largest of the ommastrephids reaching a weight of approximately 50kg and a mantle length of 1.2 m (Nigmatullin et al., 2001). It is known only from the Eastern Pacific.
Watch a video of D. gigas off California

Brief diagnosis:

An ommastrephid ...

  • with elongate, whip-like arm tips in subadults; arms with 100-200 pairs of suckers.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology/Natural History: This species is a diurnal vertical migrator from warm waters. It is only occasionally seen along our coast.

Ramos-Castillejos et al. (2010) examined the paralarvae of this species off the west coast of Baja California. The paralarvae are very similar in morphology to those of Sthenoteuthis oualaniensis. However, Ramos-Castillejos et al. found several size metrics in which the paralarvae differed. Paralarvae of Dosidicus gigas also had no intestinal photophores.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As with other squid, this pelagic cephalopod has 8 arms plus two tentacles (the arms taper to the end, while the tentacles have a wider, flattened "club" region near the tip). The suckers are on pedicels (stalked) (photo), and the suckers on the tentacles may contain hooks (photo). The body is elongated and has fins. Has an internal, flexible skeletal gladius ("pen"). As a member of Order Teuthoidea, they eye is covered with a transparent membrane, the tentacle clubs (expanded ends of the tentacles) are narrow, and the tentacles do not retract into pockets. The arms are long and angular in cross section (photo); the ventral pair of arms are longer and broader than the others. The left ventral arm of the male is a hectocotyl. The mantle is elongated (much longer than wide). This species is very large in size (mantle length up to 150 cm), and the mantle is smooth. The fins attached to the mantle are triangular, less than half as long as the mantle, and are attached along their full length. The tentacle clubs have only suckers (no hooks) (photo). The suckers are found on less than half the total length of the two longest arms or the tentacles.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Arms
    1. Arm tips attenuate, becoming whip-like in subadults; arms I with 60 to >200 pairs of suckers. Other members of the subfamily have less than 35 pairs (Wormuth, 1976).
    2. Trabeculae of dorsal protective membranes on arms project well beyond membrane.
    3. Ventral protective membrane of arms III narrow, not greater than arm width.
    4. Hecto - Medial pores variable, perhaps depending on stage of hectocotylus development; pores may be last structures to develop (Wormuth, 1975).

      Figure. Dorsal view of the tip of the hectocotylus of D. gigas. Drawing from Roeleveld (1988).


    Figure. Oral view of the base of arm II of D. gigas. Drawing from Pfeffer (1912).


    Figure. Oral of portions of the whip-like tip of arm II of D. gigas. Left - distal tip. Middle - Middle part. Right - Area where proximal arm grades into whip-like portion. Drawings from Pfeffer (1912).

  2. Tentacles
    1. Largest club suckers with small pointed teeth and one large pointed tooth in each quadrant.
    2. Club with 49-58 rows of suckers. Other members of the subfamily have 40 or fewer rows (Wormuth, 1976).
    3. Carpal locking apparatus with smooth-ringed locking suckers extending further proximally on tentacle than normal toothed suckers (Wormuth, 1976).

  3. Head
    1. Beaks: Descriptions can be found here: Lower beak; upper beak.
    2. Funnel groove with foveola and side pockets.

      Figure. Anterior funnel groove of D. gigas, 118 cm ML.Drawing from Berry (1912).

  4. Funnel
    1. Mantle component of the locking-apparatus with anterior bifurcation. A full description of the funnel/mantle locking apparatus can be seen here.
    2. Figure. Funnel/mantle locking apparatus of D. gigas. Photographs by R. Young.

  5. Photophores
    1. Small subcutaneous photophores on ventral surfaces of mantle, head and arms III-IV (Wormuth, 1976).
    2. Single ocular and two intestinal photophores present in juveniles between 12-15 and 100-140 mm ML (Nigmatullin et al., 2001).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Dosidicus gigas, otherwise known as the Humboldt or jumbo squid, inhabits the Eastern Pacific Ocean from northern California to southern Chile. This squid is believed to have both small scale migration within the Gulf of California, from the Baja peninsula to Guaymas Basin. It may also have a large scale migration as part of its life cycle, but little about their large scale migration is known.

In the past, Dosidicus gigas was only rarely spotted off of central California, but evidence now indicates that this squid has expanded its range northward through California following El Nino events which warmed northern waters. Humboldt squid have been spotted as far north as Alaska. Similarly, it has also expanded its range to southern Chile during warm water intrusions.

Biogeographic Regions: pacific ocean (Native )

  • Markaida, U., J. Rosenthal, W. Gilly. 2003. Tagging Studies on the Jumbo Squid (Dosidicus gigas) in the Gulf of California, Mexico. Fishery Bulletin, 103: 219-226.
  • Zeldberg, L., D. Louis, B. Robison. 2007. Range Expansion by the Humboldt Squid, Dosidicus gigas, in the Eastern North Pacific. PNAS, 104: 12948-12950.
  • Lovgren, S. 2003. "Researchers Shed Light on Mysterious Jumbo Squid" (On-line). National Geographic News. Accessed November 08, 2008 at http://news.nationalgeographic.com/news/2003/07/0718_030718_jumbosquid.html.
  • MarineBio.org, 2008. "Dosidicus gigas, Jumbo Squid" (On-line). Marine Bio. Accessed October 15, 2008 at http://marinebio.org/species.asp?id=249.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: This species is common much farther south. Several times in the past decade, however (e.g. 2004, 2008), large numbers of individuals have appeared off the Washington Coast and as far north as Kodiak, Alaska. Johnson and Snook give the range as Monterey, CA to San Diego.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific Ocean from 26°S to mid-Baja, California with occasional north and south expansions. Presently from about 60°N to 47°S.

Figure. Distribution map of D. gigas. Red - Common historical distribution. Purple - Recent expansion. Red , purple is the total present distribution. Expansion to the south appears to have been more frequent in the past than to the north. Historical data mostly from Wormuth (1976).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dosidicus gigas is the largest squid in the family Ommastrephidae. These squid can weigh up to 50kg and have a mantle length of up to 2m. This species, like other squid, move via jet propulsion by moving water through their mantle as well as by fin movement.

Dosidicus gigas has a long and thick mantle, tentacles containing 100-200 hooked suckers each, and a powerful beak to tear through prey. They also have well developed eyes, and chromatophore cells like other cephalopods, which allow the squid to change color and flash to communicate. Their nickname "red devil" comes from the fact that when caught by fisherman and brought to the surface, these squid turn a bright red color.

Range mass: 50 (high) kg.

Range length: 2 (high) m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: The opalescent or common Pacific squid Doryteuthis opalescens is more common in California shallow waters but is smaller (mantle length to 19 cm). The North Pacific Giant Squid Moroteuthis robusta also grows very large (up to 230 cm mantle length) but the mantle contains many fine longitudinal ridges and the fins are attached along more than half the mantle length. The tentacle clubs have 15-18 pairs of hooks in two rows along with the suckers. It is also oceanic but occasionally washes up on our shores. The only cephalopod this large commonly seen near Washington shores is the Pacific Giant Octopus, Enteroctopus dofleini, which has only 8 arms, does not have the elongated mantle nor mantle fins, and spends much of its time benthically.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Dosidicus gigas occupies vast habitat that ranges in depths from >250m during the day to near surface depths at night. This diel migration, or vertical migration between the day and night, is also characteristic of many prey species of Dosidicus gigas, so it is thought that the squid performs this vertical migration in order to follow its prey.

Although waters around and below 250 meters deep are often relatively hypoxic, Dosidicus gigas can apparently tolerate the low dissolved oxygen levels by suppressing its rate of oxygen consumption.

The squid can also migrate horizontally and travel up to 100 kilometers in a 3 to 4 day period, making it capable of long distance migrations.

Range depth: 0 to 700 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Gilly, W., U. Markaida, C. Baxter, B. Block, A. Boustany, L. Zeidberg, K. Reisenbichler, B. Robison, G. Bazzino, C. Salinas. 2006. Vertical and horizontal migrations by the jumbo squid Dosidicus gigas revealed by electronic tagging. Marine Ecology Progress Series, 324: 1-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 15 - 15
  Temperature range (°C): 26.016 - 26.016
  Nitrate (umol/L): 3.614 - 3.614
  Salinity (PPS): 33.403 - 33.403
  Oxygen (ml/l): 4.564 - 4.564
  Phosphate (umol/l): 0.459 - 0.459
  Silicate (umol/l): 3.276 - 3.276
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: 0-1200 m

Habitat: Oceanic

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dosidicus gigas is an active predator and pursues its prey. It uses suckers on its tentacles to capture prey animals and bring them towards its beak. Juveniles eat copepods and pelagic shrimp, and as Dosidicus gigas grows, its diet shifts more towards fish and other cephalopods. During their nightly vertical migration to the surface waters, adult Dosidicus gigas feed mainly on lanternfish, but will feed on a variety of other pelagic species including other fish, squids, and octopuses. Adults have been known to eat juveniles of their own species.

Animal Foods: fish; mollusks; aquatic crustaceans; other marine invertebrates; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Dosidicus gigas is a large and abundant pelagic species, and can play a very important role both as food for predators and as a mid-level carnivore. The species has very high reproductive potential, and when conditions are right, populations of the species can increase very fast.

There are also 9-12 parasitic worm species (trematodes, nematodes and cestodes) that infect the larval Dosidicus gigas, as well as a type of ciliate parasite genus found in this squid.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Juvenile Dosidicus gigas are preyed upon by juvenile carnivorous fishes, including small tunas, other squid (Sthenoteuthis oualaniensis) and gulls. Once they reach 150mm to around 250mm in length, they start to become preyed upon by dorado, large tunas (and related species), as well as large sharks, swordfish and striped marlins, fur seals, sperm whales and short-finned pilot whales.

Dosidicus gigas can alter its coloration to match its environment, and squirt ink from its ink sac in order to confuse or temporarily blind would-be predators. This squid has been known to “fly” by propelling themselves out of the water to escape attack.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most other cephalopods, Dosidicus gigas has an extremely advanced eye and has chromatophores in the skin. Because they can travel in groups of up to 1200 individuals, they use visual cues to interact with one another. On possible example in Dosidicus gigas is that individuals can make their entire body flash red, apparently when angered or irritated. This warns nearby organisms that the individual is aggressive enough to attack if provoked. Dosidicus gigas uses its tentacles to feel something that it is curious about, such as a human diver.

Communication Channels: visual ; tactile

Other Communication Modes: photic/bioluminescent ; mimicry

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Dosidicus gigas has direct development and grows very quickly; its lifespan is only about one year. The embryo develops for 6-9 days then hatches into a paralarval stage called a rhynchoteuthion when it is about 1mm. This paralarva (1-10mm mantle length) is distinguished by having its two tentacles fused into a proboscis, and survives in the upper planktonic layer. There it grows to become a juvenile (15-100mm mantle length). The juvenile then morphs into a subadult (150-350mm mantle length) before finally developing into an adult. During these developmental stages, the morphology and feeding habits of the squid changes.

Growth is fastest during the first four months of development. Dosidicus gigas has the highest juvenile development rates of all of the squid in its family. Juveniles can obtain a mantle length of up to 100mm by 45-55 days old.

  • Staaf, D., S. Camarillo-Coop, S. Haddock, A. Nyack, J. Payne, C. Salinas- Zavala, B. Seibel, L. Trueblood, C. Widmer, W. Gilly. 2008. Natural Egg Mass Deposition by the Humboldt Squid (Dosidicus gigas) in the Gulf of California and Characteristics of Hatchlings and Paralarvae. Journal of the Marine Biological Association of the United Kingdom, 88: 759-770.
  • Nigmatullin, C., K. Nesis, A. Arkhipkin. 2001. A Review of the Biology of the jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae). Fisheries Research, 54: 9-19.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History

Hatchlings are 1.1 mm ML and lack photophores. Life span is about one year based on the assumption that statolith increments are daily and this is supported by cohort analysis using length-frequency distributions although the largest specimens may exceed a year. A 770 mm ML male had 352 increments and a 860 mm ML female had 338 increments. Paralarvae and juveniles grow 5-8% in ML per day reaching 100-110 mm ML in 45-55 days. (Nigmatullin et al., 2001). Off Peru, Argüelles et al (2001), using statolith increments found the maximum age found was 354 days for a 855 mm ML male and 344 days for a 965 mm female.

Nigmatullin et al. (2001) suggest that the population consists of three groups based on size: 1) Small - males become mature at 130-260 mm ML and females at 140-340 mm ML; 2) Medium - males become mature at 240-420 mm ML and females at 280-600 mm ML; 3) Large - males become mature at 400-500 mm ML and females between 550-600 and 1000-1200 mm ML. The Small group is found predominately in and near the equatorial area, the Medium group is found throughout the whole range except at extremely high latitudes, and the Large group is found the the northern and southern peripheral regions. Off Peru, Argüelles et al (2001) found two size groups, small (<490 mm ML) and large (>520 mm ML).

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longevity of this squid is about one year on average. Larger individuals can live up to 2 years. In captivity, captured Humboldt squid rarely live past a few days.

Range lifespan

Status: wild:
2 (high) years.

Average lifespan

Status: wild:
1 years.

Average lifespan

Status: wild:
1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Dosidicus gigas only has one reproductive cycle during their lifetime, so they are known as monocyclic. Squids mate in a head to head position. Fertilization takes place inside the female. The two squids intertwine tentacles and the male places its spermatophores inside the buccal (oral) membrane of the female.

Because these squid spend much of their time below 250m, details about courtship is unknown, but sometimes mating has been observed at or near the surface. Given their well-developed brain, eyes, and chromatophore arrays, it's likely that some kind of courtship displays and behavior occur in this species, but it has not been documented.

Dosidicus gigas is believed to have only one reproductive cycle during their lifetime. Squids mate in a head to head position. Fertilization takes place inside the female. The two squids intertwine tentacles and the male places its spermatophores inside the buccal (oral) membrane of the female.

Females produce floating egg masses protected by a layer of jelly. The only documented mass found in the wild contained an estimated 0.6-2.0 million eggs (Staaf et alia, 2008). Examination of gravid females suggests that each female can produce 3-20 such masses.

Based on collections of newly hatched individuals, spawning is believed to occurs throughout the year, with peaks from October through January in the Southern Hemisphere.

Breeding season: Spawning season varies by locality

Range number of offspring: 5,000,000 to 32,000,000.

Average number of offspring: 1,200,000.

Range age at sexual or reproductive maturity (female): 184 to 395 days.

Average age at sexual or reproductive maturity (female): 236 days.

Range age at sexual or reproductive maturity (male): 196 to 276 days.

Average age at sexual or reproductive maturity (male): 219 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous ; sperm-storing

While fertilization occurs inside the female, once she lays the loose jelly-like egg batch there is no further parental investment.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Provisioning)

  • Staaf, D., S. Camarillo-Coop, S. Haddock, A. Nyack, J. Payne, C. Salinas- Zavala, B. Seibel, L. Trueblood, C. Widmer, W. Gilly. 2008. Natural Egg Mass Deposition by the Humboldt Squid (Dosidicus gigas) in the Gulf of California and Characteristics of Hatchlings and Paralarvae. Journal of the Marine Biological Association of the United Kingdom, 88: 759-770.
  • MarineBio.org, 2008. "Dosidicus gigas, Jumbo Squid" (On-line). Marine Bio. Accessed October 15, 2008 at http://marinebio.org/species.asp?id=249.
  • Nigmatullin, C., K. Nesis, A. Arkhipkin. 2001. A Review of the Biology of the jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae). Fisheries Research, 54: 9-19.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Organic composite is exceptionally robust: jumbo squid
 

The beaks of jumbo squid have exceptional hardness and stiffness in part thanks to high cross-linking density between its chitin and protein contents.

     
  "The hard tissues found in some invertebrate marine organisms represent intriguing paradigms for robust, lightweight materials. The present study focuses on one such tissue: that comprising the beak of the jumbo squid (Dosidicus gigas). Its main constituents are chitin fibers (15–20 wt.%) and histidine- and glycine-rich proteins (40–45%). Notably absent are mineral phases, metals and halogens. Despite being fully organic, beak hardness and stiffness are at least twice those of the most competitive synthetic organic materials (notably engineering polymers) and comparable to those of Glycera and Nereis jaws. Furthermore, the combination of hardness and stiffness makes the beaks more resistant to plastic deformation when in contact with blunt abrasives than virtually all metals and polymers. The 3,4-dihydroxy-l-phenylalanine and abundant histidine content in the beak proteins as well as the pigmented hydrolysis-resistant residue are suggestive of aromatic cross-linking. A high cross-linking density between the proteins and chitin may be the single most important determinant of hardness and stiffness in the beak. Beak microstructure is characterized by a lamellar arrangement of the constituents, with a weak interface that promotes crack deflection and endows the structure with high fracture toughness. The susceptibility of this microstructure to cracking along these interfaces from contact stresses at the external surface is mitigated by the presence of a protective coating." (Miserez et al. 2006:139)
  Learn more about this functional adaptation.
  • Miserez, A.; Li, Y.; Waite, J. H.; Zok, F. 2007. Jumbo squid beaks: Inspiration for design of robust organic composites. Acta Biomaterialia. 3(1): 139-149.
  • Messersmith, PB. 2008. Multitasking in Tissues and Materials. Science. 319(5871): 1767-1768.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dosidicus gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBCPH413-07|EU068697|Dosidicus gigas| ATGCGATGACTATTTTCTACAAACCATAAAGACATTGGTACTCTCTATTTTATTTTCGGTATTTGAGCAGGACTATTAGGAACTTCTCTA---AGACTAATAATCCGTACCGAACTAGGTCAACCCGGATCGCTACTAAATGAT---GATCAACTATATAACGTGGTGGTCACTGCACACGGTTTCATTATAATTTTCTTCTTAGTTATACCTATTATAATTGGAGGATTTGGTAACTGACTAGTTCCCTTAATA---TTAGGAGCCCCAGATATAGCTTTTCCACGTATAAACAACATGAGATTTTGGCTTCTTCCTCCTTCTCTAACCCTTCTACTAGCTTCTTCCGCTGTAGAAAGAGGAGCAGGAACAGGCTGAACTGTCTACCCTCCTTTATCTAGTAACTTATCCCATGCAGGCCCTTCAGTTGATTTA---GCTATTTTCTCCTTACATCTGGCTGGTGTTTCCTCTATTTTGGGAGCAATTAACTTTATTACCACTATTTTAAATATACGATGAGAAGGTCTCCAAATAGAACGACTACCCTTGTTTGCATGATCTGTCTTTATTACTGCCATCCTTTTACTACTATCATTACCTGTTTTAGCAGGA---GCTATTACTATACTCTTAACTGACCGAAATTTTAATACAACCTTTTTTGACCCAAGGGGGGGAGGAGATCCTATTTTATATCAACACCTATTTTGATTCTTTGGTCATCCCGAAGTATATATTTTAATTCTACCAGCCTTTGGTATTATTTCACATATTGTTTCTCACCACTCTTTCAAAAAA---GAAATTTTTGGAGCCTTGGGTATAATTTACGCAATATTATCTATTGGTCTACTCGGATTTATTGTATGAGCCCATCATATATTTACAGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dosidicus gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Species: 18
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Dosidicus gigas is not a species of concern and appears to be expanding its range.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The food demands of Dosidicus gigas, puts them in competition with humans for some commercially harvested fish or other squid. With climate change occurring and shifting their range, Dosidicus gigas may begin to affect fish stocks in the northern Pacific.

These squid are large enough to be a potential danger to human divers.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The Dosidicus gigas fishery is one of the largest fisheries in the Central Eastern Pacific (measured by annual tonnage caught), and is the largest cephalopod fishery in the world.

Dosidicus gigas is useful for a wide variety of research. For example, the apparent change in the distribution of this species is useful for climate change studies. The squid is also food for many recreational and commercial fisheries like tunas and billfishes.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Humboldt Squid

Humboldt Squid

The Humboldt squid (Dosidicus gigas), also known as jumbo squid, jumbo flying squid, or diablo rojo (Spanish for 'Red Devil'), is a large, predatory squid found in the waters of the Humboldt Current in the Eastern Pacific Ocean. They are most commonly found at depths of 200–700 metres (660–2,300 ft), from Tierra del Fuego to California. Recent findings suggest the range of this species is spreading north into the waters of Oregon, Washington, British Columbia, and Alaska.[1][2] Though they usually prefer deep water, between 1,000 and 1,500 squid washed up on the Long Beach Peninsula in southwest Washington in the fall of 2004.[3] They have also ventured into Puget Sound.[4]

Contents

Behavior and general characteristics

Humboldt squid are carnivorous marine invertebrates that move in shoals of up to 1,200 individuals. They swim at speeds of up to 24 kilometres per hour (15 mph/13 kn) propelled by water ejected through a hyponome (siphon) and by two triangular fins. Their tentacles bear suckers lined with sharp teeth with which they grasp prey and drag it towards a large, sharp beak.

Although Humboldt squid have a reputation of being aggressive, there is some disagreement on this subject. Some scientists claim the only reports of aggression towards humans have occurred when reflective diving gear or flashing lights have been present as a provocation. Roger Uzun, a veteran scuba diver and amateur underwater videographer who swam with a swarm of the animals for about 20 minutes, said they seemed to be more curious than aggressive.[5] In circumstances where these animals are not feeding or being hunted, they exhibit curious and intelligent behavior.[6]

Electronic tagging has shown that Humboldt squid undergo diel vertical migrations which bring them closer to the surface from dusk to dawn.[7] Humboldt squid are thought to have a lifespan of only about one year, although larger individuals may survive up to two years.[8] They may grow to 1.75 metres (5.7 ft) in mantle length (ML)[9] and weigh up to 50 kilograms (100 lb).[8] They can rapidly change their skin color from deep purplish red to white using chromatophores (specialized skin cells) in what some researchers believe is a complex communication system.[10] Experts have also stated that the squid hunt for their prey of small fish and krill in a cooperative fashion, which would be the first observation of such behavior in invertebrates.[11] Humboldt squid are known to hunt near the surface at night, taking advantage of the dark to use their keen vision to feed on more plentiful prey.

Recent research suggests that Humboldt squid are only aggressive while feeding. At other times, they are quite passive. Their behavior while feeding often extends to cannibalism and they have been seen to readily attack injured or vulnerable squid of their own shoal. This behavior may account for a large proportion of their rapid growth.[12][13]

Distribution

The Humboldt squid lives at depths of 200 to 700 m (660 to 2,300 ft) in the eastern Pacific (Chile, Peru), ranging from Tierra del Fuego north to California. It gets its name from the Humboldt Current in which it lives off the coast of South America. Recently, the squid have been appearing further north, as far as Alaska.

Body characteristics

A Humboldt squid that washed up on a Santa Barbara shoreline

Generally, the tube (or body) constitutes about 40% of the animal's mass, the fin (or wing) about 12%, the tentacles about 14%, the outer skin about 3%, the head (including eyes and beak) about 5%, with the balance (26%) made up of the inner organs.

They often approach prey quickly with all ten appendages extended forward in a cone-like shape. Upon reaching striking distance, they will open their eight swimming and grasping arms, and extend two long tentacles covered in sharp 'teeth,' grabbing their prey and pulling it back towards a parrot-like beak, which can easily cause dramatic lacerations to human flesh. The whole process takes place in seconds.

Recent footage of shoals of these animals demonstrates a tendency to meet unfamiliar objects aggressively. Having risen to depths of 130–200 metres (430–660 ft) below the surface to feed (up from their typical 700 metre (2,300 ft) diving depth, beyond the range of human diving), they have attacked deep-sea cameras and rendered them inoperable. Reports of recreational scuba divers being attacked by Humboldt squid have been confirmed.[14][15] One particular diver, Scott Cassell,[16] who has spent much of his career videotaping this species, has developed body armor to protect against attacks.[17] Each of the squid's suckers is ringed with sharp teeth, and the beak can tear flesh, although it is believed that they lack the jaw strength to crack heavy bone.[12]

Ecology

The Humboldt squid feeds primarily on small fish, crustaceans, cephalopods, and copepod. The squid uses its barbed tentacle suckers to grab its prey and slices and tears the victim's flesh with its beak and radula. The Humboldt squid is also known to quickly devour larger prey when hunting in groups. Although claims of cooperative hunting have been made for Dosidicus gigas, this behavior is unconfirmed. Until further study reveals otherwise, most researchers believe that group attacks by cephalopods on large prey are the result of many individuals attacking simultaneously but without any coordination.[18]

Scientists suspect that the recent expansion of the squid's range north along the west coast of the US is the result of some combination of overfishing of longer-lived apex predators and higher temperatures.[19]

Fishing

Image of D. gigas from the Bulletin of the United States Fish Commission

Commercially, this species has been caught to serve the European community market (mainly Spain, Italy, France and Ireland), Russia, China, Japan, South East Asian and increasingly North and South American markets.

The squid are fished at night, when it is easier to lure them with lights used by fishermen that make the plankton the squid feed on shine, which causes the squid to rise to the surface to feed. Since the 1990s, the most important areas for landings of Humboldt squid are northern Peru and Mexico.

Humboldt squid are known for their speed in feasting on hooked fish, sharks, and squid, even from their own species and shoal.[20] There are numerous accounts of the squid attacking fishermen and divers in the area.[21] Their colouring and aggressive reputation has earned them the nickname diablos rojos (red devils) from fishermen off the coast of Mexico as they flash red and white when struggling with the fishermen.[22]

Humboldt squid and El Niño

Although Humboldt squid are generally found in the warm Pacific waters off of the Mexican coast, recent years have shown an increase in northern migration. The large 1997-98 El Niño event triggered the first sightings of Humboldt squid in Monterey Bay.[2] Then, during the minor El Niño event of 2002, Humboldt squid returned to Monterey Bay in higher numbers and have been seen there year-round since then. Similar trends have been shown off the coasts of Washington, Oregon, and even Alaska, although there are no year-round Humboldt squid populations in these locations. It has been suggested that this change in migration is due to warming waters during El Niño events, but other factors, such as a decrease in upper trophic level predators that would compete with Humboldt squid for food, could be impacting the migration shift as well.[2]

Humboldt squid and ocean acidification

A study published in the Proceedings of the National Academy of Sciences found that by the end of this century ocean acidification will lower the Humboldt squid's metabolic rate by 31% and activity levels by 45%. This will lead the squid to have to retreat to shallower waters where it can uptake oxygen at higher levels.[23]

See also

References

  1. ^ Humboldt squid Found in Pebble Beach (2003)
  2. ^ a b c Zeidberg, L. & B.H. Robinson 2007. Invasive range expansion by the Humboldt squid, Dosidicus gigas, in the eastern North Pacific. PNAS 104(31): 12948–12950.
  3. ^ Aggressive eating machines spotted on our coast (2008)
  4. ^ Giant squid caught in West Seattle
  5. ^ Jumbo squid invade San Diego shores, spook divers, Associated Press, July 16, 2009
  6. ^ Behold the Humboldt squid | Outside Online
  7. ^ Gilly, W.F., U. Markaida, C.H. Baxter, B.A. Block, A. Boustany, L. Zeidberg, K. Reisenbichler, B. Robison, G. Bazzino & C. Salinas 2006. Vertical and horizontal migrations by the jumbo squid Dosidicus gigas revealed by electronic tagging.PDF Marine Ecology Progress Series 324: 1–17.
  8. ^ a b Nigmatullin, C.M., K.N. Nesis & A.I. Arkhipkin 2001. A review of the biology of the jumbo squid Dosidicus gigas (Cephalopoda: Ommastrephidae). Fisheries Research 54(1): 9–19. doi:10.1016/S0165-7836(01)00371-X
  9. ^ Glaubrecht, M. & M.A. Salcedo-Vargas 2004. The Humboldt squid Dosidicus gigas (Orbigny, 1835): History of the Berlin specimen, with a reappraisal of other (bathy-)pelagic gigantic cephalopods (Mollusca, Ommastrephidae, Architeuthidae). Zoosystematics and Evolution 80(1): 53–69.
  10. ^ http://www.squid-world.com/humboldt-squid.html
  11. ^ Behold the Humboldt squid. Tim Zimmermann, Outside Magazine, July 2006.
  12. ^ a b The Curious Case of the Cannibal squid, Michael Tennesen, National Wildlife Magazine, Dec/Jan 2005, vol. 43 no. 1.
  13. ^ Squid Sensitivity Discover Magazine April, 2003
  14. ^ http://www2.nbc13.com/vtm/news/local/article/video_giant_squid_attacks_diver/83712/
  15. ^ http://nationalzoo.si.edu/Animals/Invertebrates/Facts/cephalopods/FactSheets/Humboldtsquid.cfm
  16. ^ DeeperBlue.net - Fanatical About FreeDiving, Scuba Diving, Spearfishing & Technical Diving
  17. ^ Cassell, S. Dancing with Demons. Deeper Blue, 2005-12-15
  18. ^ Roger T Hanlon, John B Messinger, Cephalopod Behavior, p. 56, Cambridge University Press, 1996
  19. ^ http://switchboard.nrdc.org/blogs/kwing/the_new_squids_in_town.html
  20. ^ http://www.nwf.org/News-and-Magazines/National-Wildlife/Animals/Archives/2005/The-Curious-Case-of-the-Cannibal-Squid.aspx
  21. ^ http://articles.latimes.com/2007/mar/26/sports/sp-squid26/2
  22. ^ http://www.livescience.com/animals/080613-bts-squid.html
  23. ^ Rosa, Rui, and Brad A. Seibel. (2008) Synergistic effects of climate-related variables suggest future physiological impairment in a top oceanic predator. PNAS 105: 20776-0780
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!