Molecular Biology and Genetics

Molecular Biology

Barcode data: Macaria artesiaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATCTGAGCTGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGCTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCCTAATATTAGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCCTCTATTACTCTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCTTATCTTCTAATATTGCTCATGGAGGAAGCTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATCTCATCTATTTTAGGAGCTATTAACTTTATTACTACAATTATCAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTATGAGCTGTAGGTATTACCGCATTTCTTTTATTACTATCATTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACTTCATTTTTTGACCCCGCTGGAGGAGGAGATCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Macaria artesiaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Macaria artesiaria

Macaria artesiaria is a moth of the Geometridae family. It is found from the North Sea to Mongolia and the Amur River.

The wingspan is 24–28 mm. There are two generations per year with adults on wing from the end of May to July and from August to September. In the north of the range, there is one generation per year.

The larvae feed on Salix species. Larvae can be found from April to May and again from July to August. Pupation takes place between spun together leaves. It overwinters as an egg.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!