Ecology

Habitat

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2.5 - 9

Graphical representation

Depth range (m): 2.5 - 9
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 25.5 - 25.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micromelo undata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGCGGTGATTATTTTCAACAAATCATAAAGACATTGGTACCTTGTACATACTTTTTGGTATGTGATGTGGCTTGGTAGGAACCGGGTTAAGTTTATTAATTCGGTTCGAACTAGGAACAGCAGGGGCTTTCCTTGGTGATGACCATTTTTATAATGTGATTGTAACAGCTCATGCTTTTATCATAATTTTTTTTATGGTAATACCTTTAATGATTGGAGGGTTTGGAAATTGAATGGTTCCTTTATTAATTGGGGCTCCTGATATAAGATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCCTCATTAATCCTGCTTTTATCTTCTTCTTTAATAGAAGGAGGAGCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCTGGACCTATTGCTCATGGAGGATGTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATATCTTCCTTACTAGGTGCCATTAACTTCATTACAACAATTTTTAATATACGAGCTCCAGGAATTACGATAGAACGAGTAAGATTATTTGTTTGATCTGTCCTGGTAACAGCTTTCTTGTTACTTCTTTCGCTTCCAGTGTTGGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTTAATACTAGATTCTTTGATCCTGCTGGTGGAGGAGACCCTATTCTGTATCAACACTTATTCTGATTTTTTGGGCATCCTGAGGTATATATTTTAATTTTACCCGGGTTTGGTATAATTTCCCATATTTTGAGTAACTTTACAGCCAAGCCAGCCTTTGGAACATTAGGTATAATTTATGCAATAATTTCTATCGGTATTTTAGGTTTTATTGTTTGAGCTCACCATATGTTTACAGTTGGAATAGATGTAGATACTCGGGCTTATTTTACAGCTGCTACGATAGTAATTGCTGTACCTACTGGTATTAAGGTATTTAGCTGATTAATAACTCTTTATGGAAGACGAGGGCCTTTACCTGCTCCACTGTGGTGAGTATTAGGTTTTATTTTCCTTTTTACTTTAGGAGGACTAACAGGTATTGTTCTTTCAAACTCTTCTCTTGATATTGTATTACACGACACTTATTATGTAGTTGCTCATTTTCACTATGTTCTATCAATAGGAGCTGTGTTTGCAATTTTTGGTGGGTTTGTATATTGATTTCCTGTAATAACAGGAATAACTATACATGAAACATTGGCTAAAGCTCATTTCTTAGTAATGTTCTTTCCAGTTAATTTGACATTCTTCCCTCAGCATTTCTTAGGACTGGCTGGTATGCCTCGGCGGTACTCAGACTATCCTGATGCTTATTTTAAATGGAATCAAATCTCTTCATTTGGATCGTTGTTTTCAATTTTTGCTGTTATAATGTTTATTTTCATGCTATGAGAAGCTCTTTTAGCCCAACGAACAACTCTATTTTCAGAAGCTCCCTCTCTCTCGCGGGAATGAGATACAATTCTTCCTCCGGATTTTCACAGTAATACTGAAACTTCTGTAACTCCTTTATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Micromelo undata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Micromelo undatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTCCACAAATCATAAAGATATTGGTACCCTTTACATACTTTTTGGTATGTGATGTGGTCTGGTAGGGACTGGATTA---AGTTTATTAATTCGGTTCGAGTTAGGAACAGCAGGGGCTTTCCTTGGTGAT---GATCATTTTTACAATGTAATTGTAACAGCCCATGCTTTTATTATAATTTTCTTCATGGTAATACCTTTAATGATTGGGGGTTTTGGAAACTGAATGGTCCCACTTTTA---ATTGGGGCTCCTGATATAAGATTTCCTCGAATGAACAATATAAGATTCTGACTTCTTCCTCCTTCATTAATCCTACTTTTGTCTTCTTCTTTAATAGAGGGAGGAGCTGGGACTGGGTGAACCGTTTATCCTCCGCTCTCTGGGCCTATTGCCCATGGGGGGTGTTCTGTTGACCTA---GCTATTTTTTCTTTACACTTAGCAGGGATGTCTTCCCTATTAGGTGCTATTAACTTTATTACAACAATTTTTAATATGCGGGCTCCAGGGATTACTATGGAACGAGTGAGATTATTCGTTTGGTCTGTATTAGTAACAGCCTTTTTGTTACTTCTCTCTCTTCCAGTGCTAGCAGGT---GCTATTACTATGCTATTAACTGATCGAAACTTTAATACTAGATTCTTTGACCCTGCTGGTGGAGGAGATCCAATTTTATACCAGCATCTATTCTGATTTTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Micromelo undatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Micromelo undatus

Micromelo undatus, common name the miniature melo, is an uncommon species of small sea snail or bubble snail, a marine opisthobranch gastropod mollusk in the family Aplustridae.

Distribution[edit]

This species occurs in the Caribbean, Florida, Costa Rica, Panama, Bermuda, Brazil,[1] Cape Verde Islands, Canary Islands, Ascension Island, Eastern Atlantic, South Africa, Japan and the State of Hawaii.

Habitat[edit]

This species lives in shallow water, up to 5 m in depth, on soft substrates and on the algal turf areas of rocky reefs.

Description[edit]

The thinly calcified shell is covered with undulating brown lines, crossed with two other spiral lines. The shell length is 12 to 17 mm.

The large, colorful body is blue with white spots. The margin of the foot has a diffuse blue line.

Life habits[edit]

This snail feeds on cirratulinid polychaete worms. The toxins from these worms become incorporated into the snail's tissues and are then used for the bubble snail's own defense.

References[edit]

  1. ^ "Conquiliologistas do Brasil". Retrieved 2009-10-04. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!