Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cerithidea costata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCAGCAGTTGAGAGAGGAGTTGGGACTGGGTGAACTGTGTACCCCCCTTTAGCCGGTAATTTAGCGCATGCAGGGGGCTCAGTTGATCTG---GCTATTTTCTCACTCCATTTAGCTGGTGTTTCTTCCATTTTAGGTGCGGCGAACTTTATTACAACAATTATTAACATGCGATGATGGGGAATACAGTTTGAACGATTGCCTCTTTTCGTATGATCAGTAAAGATTACTGCCATTCTTCTCCTTCTGTCATTACCAGTTTTAGCTGGG---GCAATTACTATGCTTTTAACAGATCGAAACTTTAATACGGCCTTCTTTGACCCTGCGGGGGGTGGAGACCCAATTTTATACCAGCACCTCTTCTGATTCTTTGGTCATCCAGAAGTTTATATTTTGATTCTTCCCGGGTTCGGAATGATTTCTCATATTGTAACACATTACTCATCGAAAAAA---GAGACTTTTGGAACTTTAGGAATAATTTATGCTATACTAGCGATTGGAGTTTTAGGTTTTATCGTTTGAGCACATCACATATTTACAGTTGGCATGGATGTAGATACACGTGCTTACTTTACTGCTGCAACAATAATTATTGCTGTTCCGACTGGAATTAAAGTGTTTAGTTGACTC---GCAACTATTCATGGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cerithidea costata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cerithidea costata

Cerithideopsis costata is a species of small sea snail, a marine gastropod mollusk in the family Potamididae.[1]

Distribution[edit]

This marine species occurs in the Caribbean Sea and the Gulf of Mexico.

Description[edit]

The maximum recorded shell length is 21 mm.[2]

Habitat[edit]

Minimum recorded depth is 0 m.[2] Maximum recorded depth is 402 m.[2]

References[edit]

  1. ^ Bouchet, P. (2014). Cerithideopsis costata (da Costa, 1778). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=758590 on 2014-03-20
  2. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!