Overview

Comprehensive Description

Description

 The shell is roundly triangular in shape strong and heavy, with radiating ridges and varies in colour from greyish white through yellow to buff brown. The shell also has distinctive black and white markings. The interior surface of the shell is smooth with a deep purple band. It can grow up to 6 cm in length. The tip of the siphon is split. The body tissue of live specimens, especially the foot, are orange.Manila clams are indigenous to Japan and are widely used in commercial fisheries. It can tolerate water temperatures ranging from 0 to 23 °C. The Manila clam is superficially similar in shape and size to the paloured clam Tapes decussatus, however the flesh of live Manila clams, especially the foot is orange whilst in the paloured clam, the foot is white. The shell of the Manila clam also has distinctive black and white markings. When observed feeding underwater, the siphon of the Manila clam is joined but separate in the paloured clam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: The siphon of this clam is not long (even though it has a well-developed pallial notch) and the clam buries only to 10 cm depth. This clam is introduced from Asia. It was first accidentally introduced into British Columbia in 1936 along with Pacific Oyster spat. It has now become well established and is one of the main species of clam harvested along the coast of Washington and British Columbia. Moon snails Polinices lewisii don't often attack this species because the species lives so high in the intertidal. Breeds in the summer. May contain pea crab symbionts Pinnixia faba or P. littoralis. Tolarates salinity as low as 1/3 seawater. May live 14 years. May contain red tide toxins.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

As with all members of Family Veneridae, this species has no winglike extensions at the umbo, the two shells are of similar shape and the anterior and posterior ends are not highly differentiated from one another. Both valves have three well-developed cardinal teeth (photo). They have two adductor muscle scars of similar size. The umbones are near the middle of the shell. In this species the shells are oval (longer than high) and it has concentric ridges and strong radial ribs which are strongest at the posterior end. The inner ventral margin of the shell is not serrated. Color variable gray or brown, often with streaks (photo) or angular patterns. Frequently there is a purple (photo) or yellow color (photo) inside the shell. Shell has a pallial sinus (photo). The siphons are short, the black tips are separated at the end (photo), and they can be withdrawn entirely within the shell. Length up to 7.5 cm.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Asia, Central BC to southern CA.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

The overall shape is ovate. The valves are the same size and shape (equivalve), and there is no gape when they are closed. Ornamentation consists of growth lines, comarginal and radial ribs. The radial ribs are more prominent than the comarginal ribs. All ribs become stronger anteriorly and posteriorly. The central area of the shell is smoother, but the comarginal ribs become slightly stronger as the animal grows. The lunule is elongate, varies in width and can extend up to 2/3 of the anterior dorsal margin. The umbo points slightly anteriorly. The escutcheon is not well defined, but can be elongate and smoother than the overall shell; it also may be more prominent on the left valve.

The exterior coloration is highly variable and not indicative of the species (Shaw 1956). Generally, the exterior color is a light tan or brown with a dark brown lunule. There may be radial or comarginal brown stripes, or brown mottling. The interior color is white and there may be purple coloration around the margin. The purple is stronger on the posterior margin, under the ligament and in the pallial sinus.

The ligament is exterior and supported by nymphal ridges. There are three cardinal teeth on each valve. On the left valve, the central tooth is bifid, and the anterior and posterior teeth are not bifid. On the right valve, the posterior and central teeth are bifid, and the anterior tooth is not bifid. There are no lateral teeth. The anterior adductor muscle scar is slightly smaller than the posterior adductor muscle scar. The pallial sinus is rounded and extends to approximately the end of the ligament in length.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Anderson, Katherine

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: Butter clams Saxidomus gigantea have only concentric sculpture. Native littleneck clams Protothaca staminea are as high as they are long, their ridges are less prominent, their siphons are fused all the way to the tips, and the inner ventral margin of the shell is finely serrated. These other species do not have purple markings inside the shell. Another introduced species, Nuttallia obscurata, has purple markings inside the shell but the light brown periostracum is smooth and shiny.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 58.5
  Temperature range (°C): 10.151 - 24.695
  Nitrate (umol/L): 0.008 - 6.725
  Salinity (PPS): 31.893 - 34.997
  Oxygen (ml/l): 4.878 - 6.561
  Phosphate (umol/l): 0.122 - 0.943
  Silicate (umol/l): 1.242 - 15.658

Graphical representation

Depth range (m): 0 - 58.5

Temperature range (°C): 10.151 - 24.695

Nitrate (umol/L): 0.008 - 6.725

Salinity (PPS): 31.893 - 34.997

Oxygen (ml/l): 4.878 - 6.561

Phosphate (umol/l): 0.122 - 0.943

Silicate (umol/l): 1.242 - 15.658
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The Manila clam is found in the mid to upper portion of the intertidal and in protected mud-gravel beaches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: High intertidal

Habitat: Sand, mud, or gravel in the high intertidal zone. May occasionally be attached to a stone by a byssus.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Venerupis philippinarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 100 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAGCGGTGGTTTTTAAGGACTAACCATAAGGACATTGGTACTATATATTTTATATTCTCTATTTGGTCTGGCCTCATAGGAACAGGTCTTAGAATTATTATTCGTATAGAGCTTGCGATACCTGGTAAAATATTGGAAGAT---GGTCAATTATACAATTTGGTAGTGACCGCCCATGGATTGGTAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGGGGTTTCGGTAATTGGCTTATTCCATTAATGTTGAAAATTCCCGATATGGCTTTTGCACGAATAAATAACTTAAGTTTTTGGTTATTAATAGGTTCCATAATTTTGTTGTTGGGTTCTACTTATGTAGATGGTGGGGCTGGAACTGGATGAACTATCTATCCGCCGTTATCCTCTATTGGGTATCATTCGGGGCGAGCGGTGGATTTTTTAATTTTTTCTTTACACGCGGGGGGTGTGTCATCTATTTTAGCATCTATTAATTTTTTAATTACTACAGCTTTAATGCGGACAGGAGTTATGCTCATTCTTCGTAGTAGAATGTTAAGGTGATGTTTAGGTGTGACTAGATTTCTTCTGGTAGTAGCCATACCAGTACTAGCAGGAGGGTTGACGATGCTTTTATTCGATCGACACTTCAATACGACTTTTTTTGACCCTGTTGGGTTGGGGGACCCTATTTTGTTTATTCACTTATTTTGGTTTTTTGGTCACCCTGAAGTGTATATCTTAATTCTACCTGCTTTTGGAATTATCTCCCATGTAGTAAAAGCAGGGAGGTCAAAATTACAACTGTTTGGTAAAATTCCTATAATGCACGCTGTCACCTCTATTGGGTTTTTAGGGTTTATTGTGTGGGGTCATCACATGTTTACAGTTGGGATGAATGTAGATAGTCGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Venerupis philippinarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 95
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ruditapes philippinarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Venerupis philippinarum

Venerupis philippinarum is an edible species of saltwater clam, a marine bivalve mollusk in the family Veneridae, the Venus clams.

The common names of the species include "Japanese littleneck", "Manila clam", "steamer clam", "Filipino Venus", "Japanese cockle", and "Japanese carpet shell".

Contents

Description

The shell of Venerupis philippinarum is elongate, oval, and sculptured with radiating ribs (Morris, 1980). It grows to 7.5 cm (3.0 in) across and 3.5 cm (1.4 in) in width. The color is highly variable: it is commonly grayish, greenish, brownish, yellow or buff with distinct dark or light colored, with triangular mottled markings that begin at the umbo and disperse outwards. The true color can be distorted by dark gray staining, caused by anoxic mud.[citation needed] The foot of live specimens is an orange color.

The features most diagnostic for the identification of this species are the following: that the inner ventral margin of the shell is smooth; the ligament is prominent and elevated above the dorsal margin. In the living animal, the siphons are separated at the tips (Carlton, 2007). Water is drawn in and out of a clam by siphons that protrude from the posterior end of the shell. In this species, the siphons are mostly fused, and are only separate at the tips. The siphons are short relative to some other clams, which means that the clam lives burrowed only a shallow distance under the surface of the substrate. Short siphons are what inspire the common name “littleneck clam”.[citation needed]

Possible misidentifications

In western North America, this species is often confused with Protothaca staminea,[citation needed] however, V. philippinarum shells are more elongate than P. staminea. Internally, V. philippinarum has yellowish valves, with a purple suffusion near the posterior margin. Protothaca staminea lacks this purple suffusion. This species may be found together with Protothaca staminea, but tends to reside at slightly higher tide levels.[citation needed]

Habitat

This species is native from southern Siberia to China. It was introduced to the West Coast of North America with oyster spat from Japan and now occurs from the British Columbia Coast to the Central Coast of California. It lives from the mid to low intertidal zone in bays and estuaries, in mud, sandy mud and cobble, buried 2–4 cm (0.79–1.6 in) below the surface.Usually found in Philippines were its name was distinguished.

Life history

V. philippinarum breeds in the summer. Larvae then continue to grow slowly (especially in areas of crowding),[citation needed] reaching maturity at 1–2 cm (0.39–0.79 in), and will live from 7–10 years. A non-native species, V. philippinarum was introduced during the 1930s, brought over from Japan with oyster spat from Japanese oysters. It is now extremely common amongst the Pacific coast, and is highly prized for food (Morris, 1980). V. philippinarum is also capable of withstanding salinities as low as 30-50 percent of that of pure seawater, and can tolerate levels of high pollution.[citation needed]

Predators

Predators include moon snails (Euspira lewisii), the Atlantic oyster drill (Urosalpinx cinerea), Dungeness crab (Metacarcinus magister), red rock crab (Cancer productus), bat rays (Mylobatus californicus), flounder, sturgeon, willet (Catoptrophorus semipalmatus), ring billed gulls (Larus delawarensis) and raccoons (Procyon lotor) among others.

References

  • Carlton, J. T. (2007). The light and smith manual intertidal invertebrates from Central Califorina to Oregon. Berkeley and Los Angeles, CA: University of California Press
  • Cohen, Andrew (2005). Guide to the exotic species of San Francisco Bay. Retrieved June 7, 2005, from http://www.exoticsguide.org/species_pages/v_philippinarum.html
  • Dudas, S.E., McGraw, I.J., & Dower, J.F. (2005). Selective crab predation on native and introduced bivalves in British Columbia. Journal of Experimental Marine Biology and Ecology. 325, 8-17
  • Hanby, B (2005). Marine life of the Pacific northwest. Madeira Park, BC: Harbour Publishing.
  • Kozloff, E (1993). Seashore life of the northern Pacific coat. Seattle, Wa: University of Washington Press
  • Mihele, M. (2007).Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of experimental marine biology and ecology. 312, 385-398
  • Morris, R.H., Abbott, D.P., & Haderlie, E.C. (1980). Intertidal invertebrates of California. Stanford, CA: Stanford University Press
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!