Overview

Comprehensive Description

Summary

"One of the most common and cosmopolitan freshwater molluscs, Melanoides tuberculatus is found mostly in lentic habitats, but occasionally in lotic habitats, all over the world."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Melanoides tuberculata has a very broad distribution. It is found in northern and southern Africa; eastern Mediterranean countries, the entire Arabian Peninsula (except in the Empty Quarter), south and southeast Asia (including numerous records from Bangladesh, Nepal and from much of India), southern China (including records from Hong Kong and Hainan), Japan, Malaysia, and northern Australia (Yueying Liu 1979, Brown 1994, Ramakrishna and Dey 2007). It was introduced to the Americas. It is distributed throughout India except Kashmir.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Found in Africa and the eastern Mediterranean countries and throughout India, Southeast Asia, Malaysia, and southern China, north to the Ryukyu Islands of Japan, south and east through many of the Pacific islands to Northern Australia and the New Hebridis; introduced to the United States (Burch 1989). The type locality is Coromandel, India but it was introduced into the Americas in 1935 and Cuba in 1983 (Pointier et al., 2005). U.S. introductions confirmed in Oregon, California, Nevada, Idaho, Montana, Wyoming, Arizona, Colorado, New Mexico, Texas, Louisiana, Florida, North Carolina, and Hawaii (Anderson, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Melanoides tuberculatus has a very broad global distribution. It has been reported from northern and southern Africa; eastern Mediterranean countries, Saudi Arabia, south and southeast Asia, southern China, Japan, and northern parts of Australia (Yueying Liu 1979, Brown 1994, Ramakrishna and Dey 2007). It is an introduced species in North and South America. In India, this species is seen everywhere except in Kashmir."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Endemic Distribution

Non-endemic
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Elongate, conical, high shell usually light brown in colour and marked with rust-coloured spots. 10-15 slightly convex whorls, with coarse striations spirally. Operculum present. Gonads of female cream, yellow or orange in colour, those of males red in colour."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Average shell length: 20–27 mm. Some specimens may be up to 80 mm in length.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Melanoides tuberculata inhabits clear water with rocky or sandy bottom in rapid flowing mountain streams. It is also found in pools, lakes and ditches. Melanoides tuberculata is the intermediate host of Paragonimus westermani, Metagonimus trematode and Diorchitrema formosanum.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species is rarely found in temporary water bodies but may resist a broad spectrum of environmental conditions (Pointier et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Freshwater - clear water with rocky or sandy bottom in rapid flowing mountain streams, also pools, lakes and ditches."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.25 - 2

Graphical representation

Depth range (m): 0.25 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds primarily on algae.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

"Intermediate host of Paragonimus westermani (Oriental lung fluke), Metagonimus trematode, Clonorchis sinensis (Chinese liver fluke), Opisthorchis sinensis, Centrocestus formosanus, Philophthalmus sp., Haplorchis sp. and Diorchitrema formosanum."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species has been documented in Cuatro Cienegas, Coahuila, Mexico (Dinger et al., 2005). Thompson (1999) indicates it is widely introduced throughout Florida. In Hawaii, it was first recorded from Kaua'i (Cowie, 1997) with more recent records from O'ahu and Maui (Hayes et al., 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"There is little information on the population biology of Melanoides tuberculatus, but survey data suggests that it is relatively widespread and common."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Ecology

Nocturnal burrowing species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

"These snails become capable of reproduction at sizes as small as 5-10 mm in length. Females parthenogenic and ovo-viviparous. Under favourable conditions, females transfer fertilised eggs to brood pouch for hatching. 1-64 embryos produced. Juveniles 1.2-2.2 mm in size at birth."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanoides tuberculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATTTGGTATATGATCTGGCTTAGTTGGAACAGCATTAAGTCTTTTAATTCGTGCCGAATTAGGTCAACCAGGAGCTTTGCTAGGTGAC---GACCAACTATATAATGTAATTGTAACAGCTCATGCATTTGTAATAATTTTTTTCTTAGTTATACCTATAATAATTGGTGGATTTGGAAATTGATTAGTTCCGTTAATATTAGGAGCTCCAGACATAGCTTTTCCACGGCTAAATAATATAAGTTTTTGGCTTCTTCCTCCTGCTCTGCTATTACTTCTTTCTTCAGCGGCTGTTGAAAGAGGTGTAGGAACTGGTTGAACAGTATATCCTCCTTTAGCAGGAAATCTAGCTCATGCTGGTGGTTCAGTAGATCTTGCTATTTTTTCGCTTCACTTAGCTGGTATTTCATCGATTTTAGGAGCTGTAAACTTTATTACAACTATTATTAACATACGCTGACGAGGCATACAGTTTGAACGATTACCTTTATTCGTTTGGTCGGTAAAGATCACGGCCATTCTTCTATTACTTTCTTTACCGGTACTAGCTGGTGCTATTACTATGCTTTTAACAGATCGAAATTTTAACACAGCTTTTTTTGACCCGGCAGGGGGTGGTGATCCTATTCTCTATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melanoides tuberculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Madhyastha, A.

Reviewer/s
Daniel, B.A., Molur, S., Allen, D., Able, J. & García, N.

Contributor/s
Neubert, E. & Amr, Z.S.S.

Justification
Melanoides tuberculata has a worldwide distribution with no specific threats affecting it and hence it is assessed as Least Concern globally and regionally.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Found wide-ranging and common in Africa and the eastern Mediterranean countries and throughout India, Southeast Asia, Malaysia, and southern China, north to the Ryukyu Islands of Japan, south and east through many of the Pacific islands to Northern Australia and the New Hebridis; introduced to the United States

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: This species is rarely found in temporary water bodies but may resist a broad spectrum of environmental conditions (Pointier et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Red List Category & Criteria: Least Concern ver 3.1 Year Published: 2012 Assessor/s: Madhyastha, A. Reviewer/s: Daniel, B.A., Molur, S., Allen, D., Able, J. & García, N. Contributor/s: Neubert, E. & Amr, Z.S.S."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

There is no information on the population and its trends for Melanoides tuberculata, but survey data suggest that it is relatively widespread and common.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Global Long Term Trend: Increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unknown.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Melanoides tuberculata inhabits clear water with rocky or sandy bottom in rapid flowing mountain streams, which are impacted in parts of the species' range by sedimentation arising from deforestation and agriculture. The impacts of these threats on the species require research.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

One potential threat is that by sedimentation in fresh water habitats by deforestion and agriculture. Impacts of this threat still to be determined.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Research on Melanoides tuberculata's biology is recommended and potential threats to this species need to be identified.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: It has been widely introduced in the U.S. through the aquarium trade (Cowie et al., 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

Often seen in freshwater aquariums.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-rimmed melania

The red-rimmed melania, scientific name Melanoides tuberculata,[3][4] is a species of freshwater snail with an operculum, a parthenogenetic, aquatic gastropod mollusk in the family Thiaridae.

The common name comes from the presence of reddish spots on the otherwise greenish-brown shell.[5]

The species name is sometimes spelled Melanoides tuberculatus, but this is incorrect because Melanoides Olivier, 1804 was clearly intended to be feminine because it was combined with the feminine specific epithet fasciolata in the original description.[3][4]

This species is native to northern Africa and southern Asia, but it has been accidentally introduced in many other tropical and subtropical areas worldwide. It has also been accidentally introduced to heated aquaria in colder parts of the world.

Shell description[edit]

Red-rimmed melania shell, with the characteristic red spots and streaks apparent. Specimen length approximately 20 mm.

This species has an elongate, conical shell, which is usually light brown, marked with rust-colored spots.[6] An operculum is present.[6]

The average shell length is about 20–27 mm[7] or 30–36 mm, but exceptional specimens may be up to 80 mm long.[6] Shells of this species have 10–15 whorls.[7]

Distribution[edit]

This species is native to subtropical and tropical northern Africa and southern Asia.[6]

in Africa
in Asia

Prehistoric localities include Gobero in Niger in 6200–5200 BCE.[10]

Nonindigenous distribution[edit]

This species can also be found in artificially-heated indoor habitats, such as aquaria in greenhouses, and similar biotopes:

Nonindigenous distribution in the United States[edit]

This species has become established outside of its natural range in large part through the activities of aquarists.[5][6] These snails were imported to the United States by the aquarium trade as early as the 1930s.[6] Established populations exist from Florida to Texas, and the species may still be expanding its range in the West and Northeast.[6]

Some of these exotic populations have become very large, with densities of 10,000 per square metre being reported from the St. Johns River in Florida.[22] In some cases red-rimmed melanias are believed to have a negative impact on native snail populations.[5]

The nonindigenous distribution includes the United States: Arizona; San Francisco Bay, California;[6] Colorado; Florida; Hawai'i; Louisiana;[6] Montana; North Carolina; Nevada; Oregon; Utah;[6] and Texas.[6] (Unconfirmed in South Dakota, Virginia, and Wyoming.)[6]

Ecology[edit]

This is primarily a burrowing species that tends to be most active at night.

Habitat[edit]

Although normally a freshwater snail, this species is very tolerant of brackish water, and has been recorded in waters with a salinity of 32.5 ppt (1,024 specific gravity salinity).

It is however a warm-climate species. It appears to prefer a temperature range of 18 to 25°C[5] or of 18 to 32°C.[6] Research has been conducted to determine the snail's lethal high water temperature, which is about 50°C (120 degrees Fahrenheit).[6] This information is helpful in the disinfection of fishing gear and research equipment, which otherwise may inadvertently spread the snails to uninfested waters.[6][23]

This species is resistant to low oxygen levels.[24]

Feeding habits[edit]

This snail feeds primarily on algae (microalgae).

Life cycle[edit]

Red-rimmed melania females are both parthenogenic and ovoviparous.[6][25] Females can be recognized by their greenish coloured gonads while males have reddish gonads. Under good conditions, females will produce fertilised eggs that are transferred to a brood pouch where they remain until they hatch (parthenogenesis and viviparity).[22] Melanoides tuberculata has 1–64 embryos in its brood pouch.[25] Snails will begin reproducing at a size as small as 5 mm[25] or 10 mm in length and broods may contain over seventy offspring (iteroparity).[5] The size of the shell of the parent at peak release of juveniles is 20.0 mm.[25] The size of juveniles at birth is 1.2-2.2 mm.[25]

Melanoides tuberculata grows to a similar size as Tarebia granifera, are similar in size at first birth and juvenile output.[25]

It is a r-strategist species.[26]

Parasites[edit]

Melanoides tuberculata is known to carry certain parasites which can be dangerous to humans. Pinto & de Melo (2011)[27] compiled a checklist of 37 species of trematode parasites from this species of snail.[27] Eleven of those trematodes are also parasites of human.[27] These snails serve as first intermediate host for parasites which include:[5][24]

This species is a host for a trematode parasite which has been found to infect an endangered species of fish in Texas, the fountain darter.[6]

Agricultural pests[edit]

Red-rimmed melanias can sometimes be an agricultural pest species, as has been reported on Chinese cabbage plantations in Hong Kong.[5]

Aquaria[edit]

Two red-rimmed melania with eroded shells

Red-rimmed melanias are quite commonly found in freshwater aquaria, but opinion in the hobby is divided between those who see them as a pest species, and those who value their usefulness as algae-eaters and substrate-cleaners.[30] Among aquarists, these snails are known as Malayan livebearing snails or Malayan/Malaysian trumpet snails (often abbreviated to MTS).[22]

See also[edit]

References[edit]

This article incorporates public domain text from references [3][6]

  1. ^ a b c d e f g h i Madhyastha A. (2010). Melanoides tuberculatus. In: IUCN 2010. IUCN Red List of Threatened Species. Version 2010.4. <www.iucnredlist.org>. Downloaded on 3 December 2010.
  2. ^ a b Müller O. F. (1774). Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non marinorum, succincta historia. Volumen alterum. pp. I-XXVI [= 1-36], 1-214, [1-10]. Havniæ & Lipsiæ. (Heineck & Faber). page 191.
  3. ^ a b c "Species summary for Melanoides tuberculata". AnimalBase, last modified 27 March 2011, accessed 19 April 2011.
  4. ^ a b (German) "Genus: Melanoides". Molluscs of central Europe, accessed 19 April 2011.
  5. ^ a b c d e f g University of Southern Mississippi/College of Marine Sciences/Gulf Coast Research Laboratory (2005-08-03). "Fact Sheet for Melanoides tuberculata (Müller, 1774)". Gulf States Marine Fisheries Commission. Retrieved 2007-04-08. 
  6. ^ a b c d e f g h i j k l m n o p q r s Benson A. J. (2008). "Melanoides tuberculatus". USGS Nonindigenous Aquatic Species Database, Gainesville, FL. <http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=1037> Revision Date: 4/24/2006.
  7. ^ a b Glöer P. (2002). Die Süßwassergastropoden Nord- und Mitteleuropas. Die Tierwelt Deutschlands, ConchBooks, Hackenheim, 326 pp., ISBN 3-925919-60-0, page 74.
  8. ^ (French) Sarr A., Kinzelbach R. & Diouf M. (2011, in press). "Diversité spécifique et écologie des mollusques continenatux de la basse vallée du Ferlo (Sénégal). [Specific diversity and ecology of continental molluscs from the Lower Ferlo Valley (Senegal)]". MalaCo 7: 8 pp. PDF.
  9. ^ Ukong S., Krailas D., Dangprasert T. & Channgarm P. (2007). "Studies on the morphology of cercariae obtained from freshwater snails at Erawan waterfall, Erawan national park, Thailand". The Southeast Asian Journal of Tropical Medicine and Public Health 38(2): 302-312. PDF.
  10. ^ Sereno, P. C.; Garcea, E. A. A.; Jousse, H. L. N.; Stojanowski, C. M.; Saliège, J. F. O.; Maga, A.; Ide, O. A.; Knudson, K. J.; Mercuri, A. M.; Stafford Jr, T. W.; Kaye, T. G.; Giraudi, C.; n'Siala, I. M.; Cocca, E.; Moots, H. M.; Dutheil, D. B.; Stivers, J. P. (2008). "Lakeside Cemeteries in the Sahara: 5000 Years of Holocene Population and Environmental Change". In Harpending, Henry. PLoS ONE 3 (8): e2995. doi:10.1371/journal.pone.0002995. PMC 2515196. PMID 18701936.  edit
  11. ^ Vázquez A. A. & Perera S. (2010). "Endemic Freshwater molluscs of Cuba and their conservation status". Tropical Conservation Science 3(2): 190-199. HTM, PDF.
  12. ^ a b c Santos, S. B. D.; Miyahira, I. C.; Lacerda, L. E. M. D. (2007). "First record of Melanoides tuberculatus (Müller, 1774) and Biomphalaria tenagophila (d´Orbigny, 1835) on Ilha Grande, Rio de Janeiro, Brazil". Biota Neotropica 7 (3): 361. doi:10.1590/S1676-06032007000300037.  edit
  13. ^ "Melanoides tuberculatus". Stichting Anemoon, accessed 27 October 2008
  14. ^ Duggan I. C. (2002). "First record of a wild population of the tropical snail Melanoides tuberculata in New Zealand natural waters". New Zeal. J. Mar. Fresh. Res. 36: 825-829.
  15. ^ Chrosciechowski Z. Przemyslaw K y Arcas, Enrique. 1989: Caracoles (gastrópodos) de agua dulce en el Valle de Caripe Estado Monagas, Venezuela. Boletín de la Dirección de Malariología y Saneamiento Ambiental. XXIX(1-4):47-63
  16. ^ Prypchan, Sofía de., y Chrosciechowski, Przemyslaw. 1992: Invasión de las aguas dulces del litoral central venezolano (DF) por caracoles del genero Thiara (Melaniidae) Boletín de la Dirección de Malariología y Saneamiento Ambiental. XXXII(1-4):50-58
  17. ^ Pointier, Jean Pierre., Balzán C, Carlos .y Chrosciechowski, Przemyslaw. 1994: Técnicas de muestreo de los caracoles de agua dulce en Venezuela. Boletín de la Dirección de Malariología y Saneamiento Ambiental. XXXIV(1-4):1-6
  18. ^ Ojasti, Juhani., González Jiménez, Eduardo, Szeplaki Otahola, Eduardo. y García Román, Luis B. 2001: Informe sobre las especies exótica en Venezuela. Ministerio del Ambiente y de los Recursos Naturales Caracas. 207p. ISBN 980-04-1254-9
  19. ^ Lasso, Carlos A., Martínez E, Rafael, Capelo, Juan Carlos., Morales Betancourt, Mónica y Sánchez- Maya, Alejandro. 2009: Lista de los moluscos (Gastropodos_Bivalvia) dulceacuícolas y estuarinos de la cuenca del Orinoco (Venezuela). Biota Colombiana, 10(1 -2):63-74.
  20. ^ Reeves, W. K.; Dillon, R. T.; Dasch, G. A. (2008). "Freshwater snails (Mollusca: Gastropoda) from the Commonwealth of Dominica with a discussion of their roles in the transmission of parasites". American Malacological Bulletin 24: 59. doi:10.4003/0740-2783-24.1.59.  edit PDF.
  21. ^ Glöer P. & Meier-Brook C. (2003). Süsswassermollusken. DJN, pp. 134, ISBN 3-923376-02-2. page 32.
  22. ^ a b c Pererea G. & Walls J. G. (1996). Apple Snails in the Aquarium, pp 102-105. ISBN 0-7938-2085-5.
  23. ^ Mitchell A., USDA-ARS, personal communication. In: Benson A. J.. (2008). Melanoides tuberculatus. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. <http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=1037> Revision Date: 4/24/2006.
  24. ^ a b Wingard G. L., Murray J. B., Schill W. B. & Phillips E. C. (published online May 2008). "Red-rimmed melania (Melanoides tuberculatus)—A snail in Biscayne National Park, Florida—Harmful invader or just a nuisance?". U.S. Geological Survey Fact Sheet 2008–3006, 6 p. available online at http://pubs.usgs.gov/fs/2008/3006/
  25. ^ a b c d e f Appleton C. C., Forbes A. T.& Demetriades N. T. (2009). "The occurrence, bionomics and potential impacts of the invasive freshwater snail Tarebia granifera (Lamarck, 1822) (Gastropoda: Thiaridae) in South Africa". Zoologische Mededelingen 83. http://www.zoologischemededelingen.nl/83/nr03/a04 Table 2.
  26. ^ Silva E. C., Molozzi J. & Callisto M. (2010). "Size-mass relationships of Melanoides tuberculatus (Thiaridae: Gastropoda) in a eutrophic reservoir". Zoologia 27(5): 691-695. doi:10.1590/S1984-46702010000500004, PDF
  27. ^ a b c Pinto H. A. & de Melo A. L. (2011). "A checklist of trematodes (Platyhelminthes) transmitted by Melanoides tuberculata (Mollusca: Thiaridae)". Zootaxa 2799: 15-28. abstract.
  28. ^ (Spanish) Vergara D. & Velásquez L. E. (2009). "LARVAS DE DIGENEA EN Melanoides tuberculata (GASTROPODA: THIARIDAE) EN MEDELLÍN, COLOMBIA. Larval stages of digenea from Melanoides tuberculata (Gastropoda: Thiaridae) in Medellín, Colombia". Acta Biológica Colombiana 14(1): 135-142. abstract, PDF.
  29. ^ Karamian, M.; Aldhoun, J. A.; Maraghi, S.; Hatam, G.; Farhangmehr, B.; Sadjjadi, S. M. (2010). "Parasitological and molecular study of the furcocercariae from Melanoides tuberculata as a probable agent of cercarial dermatitis". Parasitology Research 108 (4): 955–962. doi:10.1007/s00436-010-2138-x. PMID 21046153.  edit
  30. ^ Riehl R. & Baensch H. (1996). Aquarium Atlas (vol. 1) p. 899, Voyageur Press, ISBN 3-88244-050-3.

Further reading[edit]

interactions with Biomphalaria glabrata:

  • Pointier J. P. (1993). "The introduction of Melanoides tuberculata (Mollusca: Thiaridae) to the island of Saint Lucia (West Indies) and its role in the decline of Biomphalaria glabrata, the snail intermediate host of Schistosoma mansoni". Acta Trop. 54:13-18.
  • Giovanelli A., Vieira M. V. & da Silva C. L. P. A. C. (2002) "Interaction between the Intermediate Host of Schistosomiasis in Brazil Biomphalaria glabrata (Planorbidae) and a Possible Competitor Melanoides tuberculata (Thiaridae): I. Laboratory Experiments." Memórias do Instituto Oswaldo Cruz 97(3): 363-369. PDF
  • Giovanelli, A.; Vieira, M. V.; Coelho Da Silva, C. L. P. A. (2005). "Interaction Between the Intermediate Host of Schistosomiasis in Brazil, Biomphalaria Glabrata (Say, 1818) and a Possible Competitor, Melanoides Tuberculata (Muller, 1774): A Field Study". Journal Molluscan Studies 71: 7. doi:10.1093/mollus/eyi004.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!