Articles on this page are available in 2 other languages: French (6), German (1) (learn more)

Overview

Comprehensive Description

Taxonomic History

Plagiolepis pygmaea r. madecassa Forel, 1892o: 241 (w.) MADAGASCAR. AntCat AntWiki

Taxonomic history

Forel, 1895d PDF: 245 (q.m.).
Raised to species: Forel, 1892l PDF: 519.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mauritius: Calebasses, Corps de Garde, Le Pouce – Rodrigues. Endemic to the Malagasy Subregion. Recorded from the Seychelles (Inner Seychelles, Amirantes, Aldabra), Comores (Mayotte) and Madagascar.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Forel, A., 1892:
  [[ worker ]]. Cette forme merite d'etre elevee au rang d'espece et d'etre separee de la P. pygmaea . Sa taille est plus svelte que celle de la pygmaea , et le milieu du mesonotum est tres distinctement etrangle, de sorte que sa portion posterieure, jointe aux stigmates postmesonotaux est aussi longue que sa portion anterieure situee devant l'etranglement. Les yeux sont aussi situes au tiers anterieur de la tete et la ponctuation piligere du thorax et de la tete est bien plus distincte que chez la pygmaea . L'abdomen a quelques soies rousses, grossieres, arrangees un peu en series.
 Meme localite que les especes precedentes, chez les termites de terre. Les exemplaress du Mangoro sont presque hoirs, luisants, plus fonces que ceux d'Andrangoloaka.
 

Forel,A., 1907:
  [[ worker ]]. Fundnotizen: Andranohinaly (Madagaskar) und Ste. Marie de Madagascar etc.
 

Forel, A., 1895:
  [[ queen ]]. - L. 2,5 mill. - Ailes plus courtes que chez la P. pygmaea , hyalines (un peu teintees de brunatre chez la P. pygmaea ). Memes differences d'avec la P. pygmaea que chez l'ouvriere.
  ([[ male ]]. - L. 1,25 mill. - Ailes hyalines, de la longueur du corps (teintees de brunatre et bien plus longues que le corps chez la P. pygmaea ). Tete presque aussi longue que large (bien plus large chez P. pygmaea ). Pattes, scapes et premier article du funicule jaunatres; le reste brunatre.
 

Forel, A., 1912:
 [[ worker ]]. Seychelles: Silhouette, terrains bas, et Mare aux Cochons; Praslin; Mahe, Anonyme Island; Felicite.
 Deja trouvee a l'ile Desroches (Amirantes).
 

Emery, C., 1894:
 - Mahe. Impossible a distinguer du type de Madagascar.
 

Forel, A., 1904:
 Madagascar merid., 4 [[ worker ]], 1899 (Sikora!).
 

Forel, A., 1907:
 [[ worker ]]. He Desroches. Espece malgache.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Fundnotizen: Andranohinaly (Madagaskar) und Ste. Marie de Madagascar etc.

License not applicable

Forel,A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

- Mahe. Impossible a distinguer du type de Madagascar.

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Cette forme merite d'etre elevee au rang d'espece et d'etre separee de la P. pygmaea . Sa taille est plus svelte que celle de la pygmaea , et le milieu du mesonotum est tres distinctement etrangle, de sorte que sa portion posterieure, jointe aux stigmates postmesonotaux est aussi longue que sa portion anterieure situee devant l'etranglement. Les yeux sont aussi situes au tiers anterieur de la tete et la ponctuation piligere du thorax et de la tete est bien plus distincte que chez la pygmaea . L'abdomen a quelques soies rousses, grossieres, arrangees un peu en series.

 

Meme localite que les especes precedentes, chez les termites de terre. Les exemplaress du Mangoro sont presque hoirs, luisants, plus fonces que ceux d'Andrangoloaka.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ queen ]]. - L. 2,5 mill. - Ailes plus courtes que chez la P. pygmaea , hyalines (un peu teintees de brunatre chez la P. pygmaea ). Memes differences d'avec la P. pygmaea que chez l'ouvriere.

 

([[ male ]]. - L. 1,25 mill. - Ailes hyalines, de la longueur du corps (teintees de brunatre et bien plus longues que le corps chez la P. pygmaea ). Tete presque aussi longue que large (bien plus large chez P. pygmaea ). Pattes, scapes et premier article du funicule jaunatres; le reste brunatre.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Madagascar merid., 4 [[ worker ]], 1899 (Sikora!).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. He Desroches. Espece malgache.

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

[[ worker ]]. Seychelles: Silhouette, terrains bas, et Mare aux Cochons; Praslin; Mahe, Anonyme Island; Felicite.

 

Deja trouvee a l'ile Desroches (Amirantes).

License not applicable

Forel, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Plagiolepis madecassa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CATTTTATATTTTATATTTGCAATTTGAGCAGGAATACTAGGCTCATCCATAAGAATAATCATTCGGTTAGAATTAGGCTCTCCCAATGCCTTAATTAATAATGACCAAATCTATAACTCAATAGTTACAAGACATGCATTCATTATAATCTTTTTTATAGTTATACCCTTCATAATTGGTGGATTTGGAAACTTCTTAGTTCCCCTAATAATCGGCTCACCAGACATAGCCTACCCCCGTATAAATAATATAAGATTTTGACTCCTACCCCCCTCTATCTCCCTTTTACTTCTAAGAAATTTTATCAATGAAGGAGTTGGAACAGGGTGGACTATCTACCCGCCTCTAGCTTCTAATATTTTTCACAATGGGCCTTCAGTTGACTTAACTATTTTCTCCCTCCATATTGCTGGAATATCTTCAATCCTAGGAGCTATTAATTTTATCTCAACTATCCTTAATATACATCATAAAAGCCTCTCCATAGACAAAATCCCCCTCTTAGTCTGATCAATTTTTATCACAGCTATCTTACTTCTCCTCTCTCTACCCGTTCTAGCGGGAGCAATCACTATACTCCTAACCGATCGTAACCTAAACACTTCTTTTTTCGACCCTTCAGGAGGAGGAGATCCAATCTTATATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Plagiolepis madecassa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 71
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!