Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anisota stigma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTGATACTTGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTATTACCCCCTTCCCTTATTCTCTTAATTTCAAGAAGAATTGTAGAAACCGGAGCTGGTACAGGATGAACAGTTTACCCCCCTCTTTCCTCTAATATTGCTCATGGAGGATCATCTGTAGACTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCCTCAATTTTAGGTGCTATTAATTTTATTACCACAATTATTAATATACGTCTCAATAATTTATCTTTTGATCAAATACCATTATTCGTTTGAGCAGTAGGTATTACAGCTTTTCTTCTTCTTTTATCTCTCCCAGTATTAGCAGGAGCTATTACTATACTTCTTACAGATCGAAATTTAAATACCTCCTTTTTTGACCCTGCGGGGGGAGGAGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anisota stigma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NU - Unrankable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Anisota stigma

The Spiny Oakworm Moth (Anisota stigma) is a moth of the Saturniidae family. It is found from Massachusetts and south Ontario to Florida, west to Minnesota, Kansas and Texas.

Larva
Eggs

The wingspan is about 45 millimetres (2 in).

The larvae mainly feed on Oak, but have also been reported on Hazel and Basswood.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!