Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypomecis roboraria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGGTCTTTAATTGGTGATGATCAAATTTATAATACCATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTAATACTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTATTACTCTTTTAATTTCTAGAAGAATCGTAGAAAATGGAGCTGGAACAGGTTGAACAGTCTACCCACCTTTATCTTCTAATATCGCTCATGGGGGAAGATCTGTAGACTTAGCTATTTTTTCTCTTCATCTAGCTGGTATCTCTTCAATTTTAGGAGCAATTAACTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGTATTACAGCATTTTTATTATTACTTTCATTACCTGTGCTAGCAGGAGCAATTACCATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hypomecis roboraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hypomecis roboraria

The Great Oak Beauty (Hypomecis roboraria) is a moth of the family Geometridae. The species can be found in Europe.

Caterpillar

The wingspan is 40–50 mm. The moths fly from May to August. [1].

The caterpillars feed on oak.

Notes[edit]

  1. ^ The flight season refers to the Belgium and The Netherlands. This may vary in other parts of the range.

Bibliography[edit]

  • Kulfan, Miroslav; Holecová, Milada; Fajčík, Jaroslav (2006). "Caterpillar (Lepidoptera) communities on European Turkey oak (Quercus cerris) in Malé Karpaty Mts (SW Slovakia)". Biologia 61 (5): 573–578. doi:10.2478/s11756-006-0092-y. ISSN 0006-3088. 
  • Kang, C.-K.; Moon, J.-Y.; Lee, S.-I.; Jablonski, P. G. (2012). "Camouflage through an active choice of a resting spot and body orientation in moths". Journal of Evolutionary Biology: no–no. doi:10.1111/j.1420-9101.2012.02557.x. ISSN 1010-061X. 
  • Simonsen, Thomas J.; Kristensen, Niels P. (2003). "Scale length/wing length correlation in Lepidoptera (Insecta)". Journal of Natural History 37 (6): 673–679. doi:10.1080/00222930110096735. ISSN 0022-2933. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!