Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypomecis roboraria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGTACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGGTCTTTAATTGGTGATGATCAAATTTATAATACCATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTCCCTCTAATACTAGGGGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCATCTATTACTCTTTTAATTTCTAGAAGAATCGTAGAAAATGGAGCTGGAACAGGTTGAACAGTCTACCCACCTTTATCTTCTAATATCGCTCATGGGGGAAGATCTGTAGACTTAGCTATTTTTTCTCTTCATCTAGCTGGTATCTCTTCAATTTTAGGAGCAATTAACTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGTATTACAGCATTTTTATTATTACTTTCATTACCTGTGCTAGCAGGAGCAATTACCATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hypomecis roboraria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hypomecis roboraria

The Great Oak Beauty (Hypomecis roboraria) is a moth of the family Geometridae. The species can be found in Europe.

Caterpillar

The wingspan is 40–50 mm. The moths fly from May to August. [1].

The caterpillars feed on oak.

Notes[edit]

  1. ^ The flight season refers to the Belgium and The Netherlands. This may vary in other parts of the range.

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!