Overview

Brief Summary

Introduction

O. knipovitchi reaches a size of at least 450 mm ML (Kubodera, et al., 1998) and is found in circumpolar Antarctic waters.

Diagnosis

An Onykia ...

  • with smooth skin (no warts, ridges or welts).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Moroteuthis knipovitchi, sp. nov.

 

 

Sta. 176, March 3, 1965. trawling depth 550-400 m. 1♀; ML – 225 mm

 

 

The structure of the gladius is with short rhachis, long wide vane and terminal cartilaginous conus; the presence of rows of hooks on the clubs, and suckers with smooth rings on the arms; a rounded funnel groove; the absence of nuchal folds and photophores.

 

These characters allow this squid to placed in the genus Moroteuthis. However as it differs from the other known species of this genus, it is here referred to as a new species.

 

Description. (Fig. 2,3). The mantle, cylindrical in its anterior half, tapers from the base of the fins toward the posterior end (Fig. 2a). The anterior dorsal margin of the mantle is slightly produced while the ventral margin is emarginated in a gentle curve.

 

The fins are large and united together into a rhombus. They are broadest in the middle of their length. The skin is thin and smooth. The head is narrower than the mantle width. The funnel, broad at its base, is gradually attenuating and reaches the lower margin of the eye opening. The funnel organ (Fig. 2d) consists of the inverted V-shaped dorsal pad and 2 oval ventral pads. The locking apparatus (Fig. 2c) consists of a longitudinal cartilaginous groove on the fun­nel and a long narrow ridge on the mantle.

 

The arms are stout, in order 2-3 = 4-1. The suckers have smooth horny rings (Fig. 2e). The suckers of the ventral arms are smaller (d-1.8 mm) than those on the others (d-2.0-2.3 mm).

 

The tentacles are long with the stalks compressed laterally. At the base of the club there is an adhesive organ consisting of 9 minute, closely sitting sucke­rs and 9 pads. The club (Fig. 2b) is slightly expanded with the swimming keel on the aboral surface. The oral surface is occupied by 13 pairs of long narrow hooks, those of the ventral row being larger than those of the dorsal. The largest is 1 cm in length. The hooks are wrapped in skin hoods. The base of each large hook is asymmetrical due the presence of a semi-circular appendage on 1 side (Fig. 2f). There is a small patch of 16 minute suckers at the distal extremity of the club.

 

The gladius (Fig. 3) with the vane running along its larger part has a ter­minal cartilaginous conus, which occu­pies about 1/6 of the length of the gladius. The terminal conus is triangular in cross section with a sharp ventral edge and flattened dorsal one.

 

The radula has 7 rows of teeth. All of the teeth are uniform unicuspid with narrow bases. There are no additional cusps (Fig. 2g). Photophores are absent. The color of the preserved animal is light violet.

 

The squid described above is a young female with minute eggs in the ovaries and moderate-sized nidamental glands, the length of which is 34 mm, i.e., 16% of mantle length.

 

The Holotype of Moroteuthis knipo­vitchi, sp. nov. is in the Zoological Insti­tute of the Academy of Sciences of the U.S.S.R. Its measurements and indices are as follows:

 

 

                                       
 

ML -

 
 

225 mm

 
 

FLI -

 
 

60%

 
 

FWI -

 
 

69%

 
 

Arms

 
 

I

 
 

44%

 
 

 
 

II

 
 

54%

 
 

 
 

III

 
 

53%

 
 

 
 

IV

 
 

53%

 
 

CLI -

 
 

35%

 
 

 

Locality: near South Georgia Island.

 

Discussion. This species is allied to M. aequatorialis Thiele, 1921, by the presence of the thin, smooth skin while the other species of Moroteuthis (M. robusta, M. ingens, M. lonnbergii, M. robsoni) have warty skin. However M. knipovitchi is distinguished from these and M. aequatorialis by the peculiarities of the radula, the teeth of which are unicuspid while the radulae of other species are characterized by the presence of additional cusps: 2 on the teeth of the central row and 1 on the 1st lateral teeth.

 

Hoyle (1912) illustrated the radula of a species which, in his opinion, was M. ingens. At the same time he pointed out its differences from that of M. ingens described by Smith (1881). I am inclined to think that this radula is related to M. knipovitchi. I have had the opportunity to examine the radula of M. ingens from specimens caught in different parts of its range – in the Scotia Sea and off New Zealand. The radula had median teeth distinctly tricuspid, and the 1st lateral ones bicuspid.

 

Diagnosis. M. knipovitchi is characterized by the smooth, thin skin, peculiar radula, the asymmetrical base of hooks of the club, and the large rhombic fins. This species is named in honour of the famous Russian oceanologist academician N. M. Knipovitch.”

 

 

(Filippova, 1972: 392-395)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

  1. Tentacles
    1. Club with 10-15 (Kubodera et al., 1998) or 13 (Filippova1972) pairs of slender hooks.
    2. Long, slender hooks of ventral series have asymmetrical bases (see drawing below).

      Figure. Oral view of tentacular club and large club hook of O. knipovitchi. Drawings from Filippova, 1972.

      Figure. Oral view of tentacular club of O. knipovitchi, 295 mm ML, female. Photograph by R. Young.

      Scanning electron micrographs of the club hooks can be found here.

  2. Mantle
    1. Skin smooth (i,e, no welts or ridges)(photograph of anterolateral mantle skin at right).

      Figure. Portion of skin on anterodorsal mantle of O. knipovitchi, 295 mm ML, female. Photograph by R. Young.

  3. Fins
    1. Rhomboidal shape, not drawn out into a tail.
    2. Length 50-60% of ML.
    3. Width ca. 70% of ML.

      Figure. Ventral view of fin of O. knipovitchi with indication of rostrum length, 295 mm ML, female. Photograph by R. Young.

  4. Gladius
    1. Rostrum short, 1/12th of GL (measured from ventral edge of conus); triangular in cross-section (dorsal surface flat, ventral surface pointed).
    2. Keel thickened posteriorly.

      Figure. Ventral view of gladius O. knipovitchi with cross-sections. Drawings from Filippova, 1972.

Comments

Except where noted, this description is taken from Filippova (1972). The slender, asymmetrical hooks, smooth skin, homodont radula (see mext page) and the rhomboidal fins characterize this species.

Additional features of the description are found here.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species has a circumpolar distribution in Antarctic waters, south of the Antarctic convergence (Kubodera et al. 1998, Vecchione et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The type locality is near South Georgia Island. This species is found only in Antarctic waters. A map of its distribution can be found here.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This oceanic species is heavily preyed upon by sperm whales and seabirds (e.g. king penguins, Aptenodytes patagonicus; and wandering albatross, Diomedea exulans (Roper and Jereb 2010, Cherel and Weimerskirch 1999). Stomach content analysis reveals that off South Georgia their diet includes krill and finfish (e.g. Gymnoscopelus nicholsi) (Collins et al. 2004). Little is known about their biology and ecology.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Filippovia knipovitchi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACATTATACTTTATCTTTGGCATTTGAGCAGGGTTATTAGGAACTTCCTTAAGTCTAATAATCCGTACCGAACTAGGACAACCAGGATCACTACTAAATGAT---GATCAACTTTACAATGTAGTAGTAACAGCCCATGGGTTTATTATAATTTTTTTTCTAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTGCCCCTTATACTAGGGGCACCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTTTGACTACTTCCTCCCTCATTAACACTATTATTGACATCTTCAGCAGTAGAAAGAGGAGCAGGGACAGGATGAACAGTTTACCCTCCTTTATCGAGAAATTTATCACATGCAGGACCTTCAGTAGACCTTGCTATTTTTTCTCTCCACTTAGCTGGAATTTCATCTATTTTGGGAGCAATTAATTTCATTACAACAATCCTAAATATACGGTGAGAAGGCTTAGAAATGGAACGTCTTCCTTTATTTGCCTGATCTGTCTTTATTACTGCAATTTTACTCCTTTTATCATTACCTGTTTTAGCTGGAGCCATTACTATATTATTAACAGATCGAAATTTTAATACTACCTTTTTTGACCCGAGGGGAGGAGGAGACCCCATCTTGTATCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Filippovia knipovitchi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at University of Alaska Fairbanks
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Young, R., Vecchione, M. & Böhm, M.

Contributor/s

Justification
Moroteuthis knipovitchi has been assessed as Least Concern. This species has a wide geographic distribution where it is unlikely to be impacted by human activities. As it occurs in the Southern Ocean there is a potential future threat from global warming, however, as an Antarctic species it is also protected by the Antarctic Treaty System. However, more research is still needed on its ecology and biology.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. However, the distribution of this species falls within territory governed by the Antarctic Treaty System of which the Convention for the Conservation of Antarctic Marine Living Resources (CCAMLR) is a part. The objective of CCAMLR is to safeguard the environment and protect the integrity of the ecosystem of the seas surrounding Antarctica and to conserve Antarctic marine living resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Filippovia knipovitchi

Filippovia knipovitchi, the smooth hooked squid, is a species of squid in the family Onychoteuthidae and the sole member of the genus Filippovia. It is found in the Antarctic and Atlantic Oceans, and reaches a mantle length of 35 cm.[1]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!