Overview

Distribution

Central Indo-Pacific to India to Japan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species has been reported from southern Japan and the coast of China from Zhejiang province to Hong Kong and includes Taiwan, Province of China (Reid and Jereb 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

pelagic, coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits sandy and muddy substrates (Norman 2003). Females attain a larger body size (up to 50 mm in mantle length) compared to males (up to 30 mm in mantle length) (Reid and Jereb 2005). Mature males have enlarged suckers on their second and fourth arm pairs (Norman 2003). Females lay clusters of round, pale orange eggs (Reid and Jereb 2005). This species has a light organ in its gill cavity which emits just enough light to hide its silhouette at night from predators (Norman 2003). It has been raised in aquaculture (Reid and Jereb 2005). This species is very similar in appearance and distribution range to Euprymna morsei, in fact females are indistinguishable from one another (Norman 2003). Members of the subfamily Sepiolinae are bottom living species that typically bury in soft sediments during the day, and emerge at night to feed (Norman 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dispersal

Depth range

depth range to 107 m.
  • Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Euprymna berryi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Euprymna berryi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGTACTTTATATTTTATTTTTGGTATCTGATCTGGCTTATTAGGAACTTCTTTGAGTTTAATGATTCGAACTGAACTAGGAAAACCTGGTTCATTATTAAATGAT---GATCAATTATATAACGTAGTAGTAACTGCGCACGGTTTTGTTATAATTTTCTTTTTAGTTATACCAATTATAATTGGGGGGTTTGGTAATTGATTAGTCCCTTTAATGTTAGGGGCCCCTGATATGGCTTTCCCACGTATAAATAATATAAGGTTTTGATTGCTACCCCCCTCATTATCATTACTACTAGCCTCTTCGGCAGTAGAAAGGGGTGCAGGTACAGGATGGACTGTGTACCCTCCATTATCAAGTAATATTTCACATGCAGGCCCTTCAGTAGACCTAGCTATTTTTTCTCTTCATTTAGCAGGAGTATCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATAAATATACGCTGAGAAGGACTACAAATGGAACGAATACCTTTATTTGTATGATCTGTTTTTATTACAGCCATTTTACTATTATTATCCCTACCTGTTTTAGCTGGAGCAATTACAATACTATTAACTGACCGAAACTTCAATACAACCTTTTTTGATCCAAGAGGGGGTGGTGATCCTATTTTATACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Euprymna berryi has been assessed as Data Deficient due to the persistence of taxonomic problems in the delineation of species in this genus. It is taken in small local fisheries and eaten locally, but without good distribution data it is impossible to determine whether it is impacted by any threats on a global scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is caught and consumed locally in regions where it is abundant (Reid and Jereb 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Further research is required to resolve taxonomic uncertainties and determine population trends and life history patterns of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Euprymna berryi

Euprymna berryi, commonly called Humming-bird Bobtail Squid or Berry's bobtail squid among various other vernacular names, is a species mollusc cephalopod in the family Sepiolidae.[2]

The Humming-bird Bobtail Squid is widespread throughout the tropical waters of the central Indo-Pacific area from the Indonesia to the Philippines.[3]

Its size varies according to the sex, males are not bigger than 3 centimetres (1.2 in) while the female reaches 5 centimetres (2.0 in) length.[4]

References[edit]

  1. ^ Barratt, I. & Allcock, L. 2012. Euprymna berryi. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 19 October 2013.
  2. ^ http://fran.cornu.free.fr/affichage/affichage_nom.php?id_espece=1347
  3. ^ http://www.iucnredlist.org/details/162599/0
  4. ^ http://fran.cornu.free.fr/affichage/affichage_nom.php?id_espece=1347
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!