Articles on this page are available in 1 other language: French (2) (learn more)

Overview

Comprehensive Description

Taxonomic History

1 subspecies

Vespa helvola Linnaeus, 1764: 412 (m.) SOUTH AFRICA. AntCat AntWiki

Taxonomic history

Linnaeus, 1767: 968 (w.); Emery, 1888b PDF: 344 (q.).
Combination in Dorylus: Fabricius, 1793 PDF: 365.
Current subspecies: nominal plus Dorylus helvolus pretoriae.
See also: Arnold, 1915: 116.
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Reference for Kenya if not type: Santschi 1914b
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Emery, C., 1895:
 - Cape-Town, Bloemfontein, Makapan, Hebron, [[ worker ]].
 

Santschi, F., 1914:
  Mus. Ludov. Ulr., p. 412 (1764), [[male]] ( Vespa helvola ). - Fred; Smith, Cat. Hymenopt. Brit. Mus., vol. 6, p. 112 (1858),.[[worker]] [ Typhlopone punctata ). - Emery, apud P. Wystman, Genera Insectorum, Hymenopt. Formicidae, Dorylinae , fase. CII, p. 10 (1910), [[queen]], [[worker]],[[male]].
 Afrique orientale anglaise: region du Kenya: foret entre Nyere et la riviere Amboni (alt. 1800 m., st. n° 52, fevr. 1912), 8 [[worker]] media et minorDistribution geographique. - Le Cap, Natal, Mozambique.
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

- Cape-Town, Bloemfontein, Makapan, Hebron, [[ worker ]].

License not applicable

Emery, C.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mus. Ludov. Ulr., p. 412 (1764), [[male]] ( Vespa helvola ). - Fred; Smith, Cat. Hymenopt. Brit. Mus., vol. 6, p. 112 (1858),.[[worker]] [ Typhlopone punctata ). - Emery, apud P. Wystman, Genera Insectorum, Hymenopt. Formicidae, Dorylinae , fase. CII, p. 10 (1910), [[queen]], [[worker]],[[male]].

 

Afrique orientale anglaise: region du Kenya: foret entre Nyere et la riviere Amboni (alt. 1800 m., st. n° 52, fevr. 1912), 8 [[worker]] media et minorDistribution geographique. - Le Cap, Natal, Mozambique.

License not applicable

Santschi, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Dorylus helvolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dorylus cf. helvolus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Dorylus helvolus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGCTTTATGATCTGGAATTCTTGGATCATCAATAAGAATAATTATTCGATTAGAGCTAGGTACATGTGGAAGAATAATTTTCAAT---GATCAAGTTTTTAATACTATTGTTACTAGACATGCATTTATTATAATTTTTTTTATAGTCATGCCATTTATAATCGGAGGTTTCGGAAACTTTATTGCACCTTTAATAATTGGAGCACCTGATATGGCTTACCCTCGTATAAATAATATAAGATTTTGATTATTACCACCTTCTATTACTTTAATAATTATGAGAAACTTTATCGGAACTGGAGCAGGAACAGGTTGAACTGTTTACCCTCCTCTAGCTTCAAATATTTATCATAGAGGGGCTTCTATTGATCTAACTATTTTTTCATTACATATCGCCGGTATGTCTTCAATTTTAGGAGCAATTAATTTTATTTCTACAATTATTAATATACACCATAAAAACTTAACTATAGACAAAACCCCCTTATTTGTTTGATCAATTTTAATTACAGCTATTCTATTACTATTATCATTACCTGTTTTAGCTGGGGCAATCACCATATTATTAACTGACCGTAATATTAATACATCATTTTTTGATCCCTCAGGTGGGGGAGACCCGATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!