Articles on this page are available in 1 other language: Dutch (2) (learn more)

Overview

Brief Summary

The American piddock is an elongated white shell. It was introduced into the southeastern section of the North Sea at the end of the 19th century. It drills itself into wood and blocks of peat with the toothed ribs of its shell as grater. It doesn't eat the wood or peat, but filters plankton out of the seawater. Other piddocks also have the same lifestyle, even though they are not related to one another. The American piddock is displacing the indigenous white piddock and oval piddock.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The piddock has a thin, brittle shell that is similar in shape and sculpturing on both sides. The beaks (tips) of each valve are in the anterior half and turn downward and inwards. The whole shell appears in outline to be elongate and oval with a maximum length of ca 6.35 cm. The surface of the shell is sculptured with numerous concentric lines crossed by >40 radiating ribs, which in the anterior half of the shell are large and coarse, bearing prominent spines. Outer surface of shell is off-white or fawn in colour with a dark brown periostracum. The ligament (which opens the shell) is external and prominent, stretching a quarter of the way between the beaks to the posterior margin. Petricola pholadiformis may be confused with Barnea candida, the native white piddock of the Pholadacea (Tebble, 1976).Common names
Petricola pholadiformis may also be known as the 'false angel wing'.
 Method of introduction and spread
Petricola pholadiformis is a non-native, boring piddock that was unintentionally introduced from America with the American oyster, Crassostrea virginica, not later than 1890 (Naylor, 1957). Rosenthal (1980) suggested that from the British Isles, the species has colonized several northern European countries by means of its pelagic larva and may also spread via driftwood, although it usually bores into clay, peat or soft rock shores.
In Belguim and The Netherlands Petricola pholadiformis has almost completely displaced the native piddock, Barnea candida (ICES, 1972). However, there is no documentary evidence to suggest that native piddocks have been displaced in the British Isles (J.Light & I.Kileen pers. comm. to Eno et al., 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Cobscook Bay, Gulf of Maine, Gulf of St. Lawrence, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel); Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 486 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 0 - 56.4
  Temperature range (°C): 10.269 - 23.867
  Nitrate (umol/L): 1.522 - 5.451
  Salinity (PPS): 33.451 - 36.067
  Oxygen (ml/l): 4.890 - 6.252
  Phosphate (umol/l): 0.195 - 0.522
  Silicate (umol/l): 1.685 - 3.064

Graphical representation

Depth range (m): 0 - 56.4

Temperature range (°C): 10.269 - 23.867

Nitrate (umol/L): 1.522 - 5.451

Salinity (PPS): 33.451 - 36.067

Oxygen (ml/l): 4.890 - 6.252

Phosphate (umol/l): 0.195 - 0.522

Silicate (umol/l): 1.685 - 3.064
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 67 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 31.55
  Temperature range (°C): 21.498 - 21.498
  Nitrate (umol/L): 0.748 - 0.748
  Salinity (PPS): 34.083 - 34.083
  Oxygen (ml/l): 5.180 - 5.180
  Phosphate (umol/l): 0.241 - 0.241
  Silicate (umol/l): 2.493 - 2.493

Graphical representation

Depth range (m): 0 - 31.55
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Petricola pholadiformis is a mechanical borer into hard clay, chalk, solid mud, peat-moss and limestone from the midtide level to low water. Although dredged from a depth of 8 m, its occurrence in deeper water is not known (Tebble, 1967).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The natural distribution area of the false angelwing Petricolaria pholadiformis was limited to the east coast of North America, but was brought to Europe (England) around 1890 together with the transport of the eastern oyster Crassostrea virginica. The planktonic larvae of the false angelwing could subsequently reach the rest of Europe by hitch hiking on the sea currents. The species was first observed in Belgian waters at Nieuwpoort in 1899. In Today, the false angelwing can mainly be found along the east part of Belgian's coast. This bivalve drills passageways in peat blocks, wood, hard clay and limestone. Living individuals are often found in washed ashore peat blocks. Empty shells are frequently found on Belgian beaches.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Petricolaria pholadiformis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTGGTACTTGTTGTTCTCTTTTTGATCCGGTTTAATGGGTACGGCTTTCAGTGTGATTATTCGTATGGAATTGGCTCATCCGGGGACTATTTTAGATGAT---GCTCATTTGTATAATTTTGTCGTTACTTCTCATGGTTTAGTGATAATTTTTTTCTTAGTAATACCAATAACTTTAGGTGGTTTTGGTAATTGATTAGTCCCTTTAATATTAGGCGCTCCTGACATAAGATATCCTCGTCTGAATAACCTAAGTTTCTGGTTGTTACCCGTTTCTATAATATTATTCTTAGGTTCTGGATACGTAGACGGGGGAGCTGGTACTGGGTGAACTTTATATCCTCCGTTATCAAGGGGTACTTTCCATTCTGGGGTTTCAGTGGATTATTTAATTTTATCTTTACATGTGGGGGGAATGTCTTCTATTGTAGCGGGAATTAATTTTACGGCTACTGGTTTATGTTTGCGTTCAAGAGTTATGTCACTACTTCGAACAACCTTATTTGTTTGGTGTATTAGTGTAACGGCTTTCTTACTAGTGTGTGCTATACCAGTTCTGGCTGCGGGGTTGACTATGTTAATTACTGATCGAAATTTTAATACTAGTTTTTTTGATCCTAGTGGTTTGGGGGATCCTTTATTATTTGTTCACCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Petricolaria pholadiformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

False angelwing

Petricolaria pholadiformis, common names "false angel wing" (USA) and "American piddock" (UK), is a species of saltwater clam, a marine bivalve mollusk in the family Petricolidae, which is related to the large family Veneridae, the Venus clams.

Contents

Description

Petricolaria pholadiformis closely resembles the angel wing (Cyrtopleura costata), the main distinguishing feature being that it lacks the apophyses, the spoon-shaped wings located near the beak, of the real angel wing. It grows to about 5 centimetres (2.0 in) long and is usually white. The anterior end is extended and has a rounded point while the posterior end is blunt and curved. There are ridges radiating from the beak, which are more pronounced at the posterior end, and fainter growth rings running parallel with the margin.[1]

Distribution

Indigenous

This species is native to the Eastern Coast of North America including the Gulf of Mexico.[1]

Introduced

This clam was introduced and has become established in the British Isles, and on the West Coast of North America.[2][3]

A beachworn right valve of Petricolaria pholadiformis, from Wales

References

  1. ^ a b False Angel Wing: A Piddock for Your Thoughts Retrieved 2011-11-30.
  2. ^ False Angelwing: Petricolaria pholadiformis Elkhorn Slough Research. Retrieved 2011-11-30.
  3. ^ Petricolaria pholadiformis Marlin. Retrieved 2011-11-30.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!