Overview

Distribution

Range Description

This species has a geographic distribution that extends from southern Japan (central Honshu), along the coast of China to Viet Nam in the south (Reid et al. 2005). Its range encompasses Taiwan, Province of China and northern Philippines, as well as the East and South China Seas (Reid et al. 2005). Its range may extend further south to Singapore and Indonesia (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is demersal and inhabits sandy substrates (Reid et al. 2005). It feeds on crustaceans and small fish. Animals move into deep water during winter and return to shallow waters in spring to spawn (Norman 2003). Spawning occurs between spring and early summer (Reid et al. 2005). Males guard females and prior to mating the male gives colourful displays (Reid et al. 2005). The eggs are often laid onto elongate substrates such as seaweed and sunken branches (Reid et al. 2005). The sticky egg cases accumulate debris as camouflage (Reid et al. 2005). Depending on water temperature the direct developing young hatch in about 30 to 80 days (Reid et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 62 - 82
  Temperature range (°C): 23.253 - 23.253
  Nitrate (umol/L): 1.362 - 1.362
  Salinity (PPS): 34.324 - 34.324
  Oxygen (ml/l): 4.843 - 4.843
  Phosphate (umol/l): 0.338 - 0.338
  Silicate (umol/l): 6.809 - 6.809

Graphical representation

Depth range (m): 62 - 82
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sepia esculenta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sepia esculenta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGACTTTTCTCCACTAACCATAAAGATATTGGCACATTATACTTTATTTTTGGTATTTGATCTGGTTTATTAGGGACTTCTTTAAGCCTAATAATTCGAAGAGAGTTAGGTAAGCCCGGTACCTTATTAAATGAT---GATCAACTATATAATGTTGTAGTAACCGCTCATGGGTTCATTATAATTTTTTTTTTAGTAATACCTATTATAATTGGGGGGTTTGGTAACTGACTAGTACCATTAATACTAGGTGCACCAGATATAGCATTCCCACGTATAAATAATATAAGATTTTGATTACTTCCTCCTTCATTAACCTTACTTTTATCTTCTTCCGCCGTGGAAAGGGGAGCAGGAACAGGATGAACTGTCTACCCTCCTTTATCAAGTAACCTCTCACATGCAGGACCTTCTGTCGATTTGGCAATTTTTTCATTACACCTGGCTGGTGTATCATCAATTCTAGGGGCTATTAATTTTATTACAACTATTTTAAATATACGTTGAGAAGGCCTACAAATAGAGCGATTACCTTTATTTGCCTGATCTGTATTTATTACAGCTATTTTATTACTTTTATCTCTTCCTGTGTTGGCAGGGGCTATTACAATGCTATTAACAGATCGAAATTTTAATACCACATTTTTTGACCCAAGAGGAGGTGGAGACCCTATTTTATACCAACACTTATTTTGGTTTTTTGGGCACCCAGAAGTTTATATTTTAATTTTACCTGCATTTGGTATTATTTCACATATTGTCTCACATCACTCACTTAAAAAAGAAACTTTTGGGTCATTAGGCATAATTTATGCTATGCTATCTATTGGTTTATTAGGATTTATTGTTTGAGCCCATCATATATTTACAGTGGGTATAGACGTAGATACACGAGCTTATTTTACATCGGCAACAATGATTATTGCTATTCCTACAGGTATTAAAGTATTTAGTTGATTAGCCACTATTTATGGTTCA---CCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Sepia esculenta has been assessed as Data Deficient as it has a wide geographic distribution and is only fished intensively in certain regions (e.g. East China Sea). Hence the species as a whole is likely unaffected by fishing activity but there are not enough data available to confirm this. Therefore, we currently consider this species to be Data Deficient.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Ocean acidification caused by increased levels of carbon dioxide in the atmosphere is potentially a threat to all cuttlefish. Studies have shown that under high pCO2 concentrations, cuttlefishes actually lay down a denser cuttlebone which is likely to negatively affect buoyancy regulation (Gutowska et al. 2010). This species is fished commercially in the East China Sea and for subsistence off the Philippines (Reid et al. 2005). Its flesh is considered tasty in many Asian countries, for example China and Japan (Reid et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Research is required into trends in population size and the impacts of harvesting and threats impacting this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!