Overview
Distribution
FAO fishing area 61, FAO fishing area 71, Japan, West North Pacific
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=124589
Trusted
Ecology
Habitat
shelf
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 62 - 82
Temperature range (°C): 23.253 - 23.253
Nitrate (umol/L): 1.362 - 1.362
Salinity (PPS): 34.324 - 34.324
Oxygen (ml/l): 4.843 - 4.843
Phosphate (umol/l): 0.338 - 0.338
Silicate (umol/l): 6.809 - 6.809
Graphical representation
Depth range (m): 62 - 82
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): 62 - 82
Temperature range (°C): 23.253 - 23.253
Nitrate (umol/L): 1.362 - 1.362
Salinity (PPS): 34.324 - 34.324
Oxygen (ml/l): 4.843 - 4.843
Phosphate (umol/l): 0.338 - 0.338
Silicate (umol/l): 6.809 - 6.809
Graphical representation
Depth range (m): 62 - 82
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sepia esculenta
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 4 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ATGCGATGACTTTTCTCCACTAACCATAAAGATATTGGCACATTATACTTTATTTTTGGTATTTGATCTGGTTTATTAGGGACTTCTTTAAGCCTAATAATTCGAAGAGAGTTAGGTAAGCCCGGTACCTTATTAAATGAT---GATCAACTATATAATGTTGTAGTAACCGCTCATGGGTTCATTATAATTTTTTTTTTAGTAATACCTATTATAATTGGGGGGTTTGGTAACTGACTAGTACCATTAATACTAGGTGCACCAGATATAGCATTCCCACGTATAAATAATATAAGATTTTGATTACTTCCTCCTTCATTAACCTTACTTTTATCTTCTTCCGCCGTGGAAAGGGGAGCAGGAACAGGATGAACTGTCTACCCTCCTTTATCAAGTAACCTCTCACATGCAGGACCTTCTGTCGATTTGGCAATTTTTTCATTACACCTGGCTGGTGTATCATCAATTCTAGGGGCTATTAATTTTATTACAACTATTTTAAATATACGTTGAGAAGGCCTACAAATAGAGCGATTACCTTTATTTGCCTGATCTGTATTTATTACAGCTATTTTATTACTTTTATCTCTTCCTGTGTTGGCAGGGGCTATTACAATGCTATTAACAGATCGAAATTTTAATACCACATTTTTTGACCCAAGAGGAGGTGGAGACCCTATTTTATACCAACACTTATTTTGGTTTTTTGGGCACCCAGAAGTTTATATTTTAATTTTACCTGCATTTGGTATTATTTCACATATTGTCTCACATCACTCACTTAAAAAAGAAACTTTTGGGTCATTAGGCATAATTTATGCTATGCTATCTATTGGTTTATTAGGATTTATTGTTTGAGCCCATCATATATTTACAGTGGGTATAGACGTAGATACACGAGCTTATTTTACATCGGCAACAATGATTATTGCTATTCCTACAGGTATTAAAGTATTTAGTTGATTAGCCACTATTTATGGTTCA---CCT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sepia esculenta
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 12
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
