Physical Description

Type Information

Lectotype for Pthirus gorillae Ewing, 1927
Catalog Number: USNM
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Preparation: Slide
Collector(s): B. Burbridge
Year Collected: 1923
Locality: Belgian Congo, Unknown, Zaire
  • Lectotype: 1927. Proceedings of the Entomological Society of Washington. 29: 120.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Entomology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pthirus gorillae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTAGTTCCTTTATTCTTAGGTGCTCATGATATGGCTTTTCCTCGGATGAACAATATAAGCTATTGACTGATTATACCCTCTGGAATTTTATTAATTGCTAGTTCGGTAGTCCAAGGTGGAACAGGTACCGGCTGAACTGTTTACCCTCCTCTTAGTTCACTGGTAGGTCAGCCTTCTTTGTCGGTGGATTTCACTATCTTTAGCCTGCATTTAGCGGGTGTAAGTTCTATTTTAGGCTCAGTAAACTTTATTAGAACGATTTTAAATATATGACCTTCAAGGCTGAAGATTTTTCGACTGCCTTTGTTCTGTTGGTCTGTTTTGGTTACAGCTTTCTTGCTATTACTATCTTTACCTGTACTCGCGGGTGCTATCACTATGCTACTACTAGACCGGAACTTTAATTGTTCTTTTTTCGACCCTCTAGGGGGGGGCGACCCTATTCTCTATCAGCATCTTTTTTGGTTTTTTGGGCATCCTGAGGTATACATCTTGATTCTTCCCGGGTTCGGGCTAATTTCCCACATGGTTGTTGATTTAAGAGGTAAGAAGGAGGTGTTCGGTTCTTTAGGAATGATCTATGCTATAGTGTCGATCGGTGTCTTAGGTTTTGTTGTTTGAGCCCACCATATATTTACTGTTGGGTTAGACGTAGATAGCCGTGCTTACTTTACTAGAGCCACTATAACTATTGCTATCCCGACGGGAGTAAAGGTTTTTAGCTGGTTAGGTACTTTATTTGGGCCT---AAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pthirus gorillae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pthirus gorillae

Pthirus gorillae or gorilla louse is a species of parasitic sucking louse that afflicts gorillas.[1] It is found in the African continent, specifically in Rwanda and Democratic Republic of the Congo.[2] Pthirus gorillae and Pthirus pubis (the crab louse) are the only known species that belong to the genus Pthirus, often incorrectly spelled as Phthirus (the Latin for louse is phthir).[3] It is suggested that it is transmitted among its hosts by social grooming, shared breeding and sexual contact.[4]

All species of sucking lice feed on blood.[5] They live in close association with their hosts and complete their entire life cycle on the host.[1] Pthirus gorillae infests the same parts of the bodies of gorillas as Pthirus pubis does in humans,[6] but since the gorilla is so much more hirsute, the lice tend to range over the whole body.[7] The two also resemble each other with the exception that Pthirus gorillae has large eyes that are placed on large lateral protuberances. A short and broad sucking louse, it is about 2.20 mm long with sprawling legs and not more than 20 small abdominal setae.[4] While morphologically these species are indistinguishable, they are clearly different in terms of behaviour, microhabitat preference and vector status.[5]

It was first identified from specimens of mountain gorillas in 1927 by Henry Ellsworth Ewing during a game hunting trip in what is now the Democratic Republic of the Congo.[4] Molecular phylogenetics suggests that Pthirus gorillae jumped from gorillas to early humans 3.3 million years ago and diverged into the present-day pubic louse.[1][8] Researchers theorize that humans acquired the parasite while butchering or scavenging on gorilla corpses, or sleeping in the abandoned sleeping nests of gorillas.[9][10]

References[edit]

  1. ^ a b c David L. Reed, Jessica E. Light, Julie M. Allen & Jeremy J. Kirchman (2007). "Pair of lice lost or parasites regained: the evolutionary history of anthropoid primate lice". BMC Biology 5: 7. doi:10.1186/1741-7007-5-7. PMC 1828715. PMID 17343749. 
  2. ^ "Pthirus gorillae Ewing, 1927". Integrated Taxonomic Information System. Retrieved 30 September 2010. 
  3. ^ Robert Frederick Harwood & Maurice Theodore James (1979). Entomology in human and animal health. Macmillan. p. 130. ISBN 978-0-02-351600-9. 
  4. ^ a b c Jessica M. Rothman, Dwight D. Bowman, Gladys Kalema-Zikusoka & John Bosco Nkurunungi (2006). "The Parasites of the Gorillas in Bwindi Impenetrable National Park Uganda". In Nicholas E. Newton-Fisher, Hugh Notman & James Durward Paterson. Primates of Uganda. Springer Science+Business Media. pp. 171–192. ISBN 978-0-387-32342-8. 
  5. ^ a b Jonathan F. Day, John D. Edman, Sidney E. Kunz & Stephen K. Wikel (2004). "Direct Injury: Phobias, Psychoses, Annoyance, Allergies, Toxins, Venoms and Myiasis". In Bruce F. Eldridge & John D. Edman. Medical Entomology: A Textbook on Public Health and Veterinary Problems. Kluwer Academic Publishers. pp. 99–149. ISBN 978-1-4020-1794-0. 
  6. ^ Robert S. Anderson, Richard Beatty & Stuart Church (2003). "Sucking louse". Volume 5. Harvester ant–Leaf-cutting ant. Insects and Spiders of the World. Marshall Cavendish. pp. 520–523. ISBN 978-0-7614-7339-8. 
  7. ^ Sydney Harold Skaife & Anthony Bannister (1979). African Insect Life. C. Struik. p. 83. ISBN 978-0-86977-087-0. 
  8. ^ May R. Berenbaum (2009). "The Domesticated Crab Louse". The Earwig's Tail: A Modern Bestiary of Multi-legged Legends. Harvard University Press. pp. 24–28. ISBN 978-0-674-03540-9. 
  9. ^ Roxanne Khamsi (7 March 2007). "Pubic lice leapt from gorillas to early humans". New Scientist. 
  10. ^ Jesse Bering (1 March 2010). "A bushel of facts about the uniqueness of human pubic hair". Bering in Mind. Scientific American. Retrieved 30 September 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!