Overview

Comprehensive Description

Taxonomic History

Lasius (Chthonolasius) balcanicus Seifert, 1988: 152, figs. 9, 19, 28, 37, 42, 46-52 (w.q.m.) BULGARIA. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

2 localities in SW & SE SLO
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

Source: AntWeb

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Records

 

(Map 50): Sofia Basin: Sofia ( Antonova and Penev 2006 , 2008 ); Plana Mt.: Bukov dol loc. (Pasarel vill.), Peyova buka hut (Pasarel vill.) ( Vagalinski and Lapeva-Gjonova in press ); Pirin Mt.: Rozhen ( Seifert 1988b ); Western Rhodopi Mts: Dospat ( Lapeva-Gjonova in press (a) ); Northern Black Sea coast: Obzor vill. ( Seifert 1988b ).

 

Notes:

 

This species was omitted by Atanassov and Dlusskij (1992) .

License not applicable

Lapeva-Gjonova, Albena

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lasius balcanicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTTCTCTCCTTCTATTAAGAAATTTTATTAATGATGGGGTTGGAACAGGATGAACTGTTTACCCCCCATTAGCCTCAAATATTTTTCATAATGGCCCCTCAGTTGATTTA---ACTATTTTCTCCCTTCATATCGCTGGAATCTCCTCTATTTTAGGAGCTATTAATTTTATTTCAACCATTATAAATATACACCATAAAAATTTTTCTATCGATAAAATACCTTTACTTGTATGATCAATTTTAATTACTGCAATTTTATTACTTTTATCTCTTCCAGTTCTTGCAGGA---GCTATTACAATACTTCTAACTGACCGTAATCTTAATACTTCATTTTTTGATCCATCAGGTGGGGGAGATCCTATTTTATATCAACATCTTTTCTGATTTTTTGGACATCCAGAAGTTTATATTTTAATTCTTCCTGGATTTGGATTAATTTCCCATATCATTATAAATGAAAGTGGGAAAAAA---GAAACATTTGGATCTTTAGGAATAATTTATGCCCTTATAGCAATTGGATTTTTAGGATTTGTTGTTTGAGCTCATCATATATTTACTATTGGTCTAGATGTCGATACTCGTGCATATTTTACTTCAGCAACAATAATTATTGCCATTCCAACAGGAATTAAAATTTTTAGATGAATTACC---ACT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lasius balcanicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!