Overview

Brief Summary

The human hookworms include the nematode species Necator americanus and Ancylostoma duodenale. A larger group of hookworm species normally infecting non-human animals can invade and parasitize humans or can penetrate the human skin--causing cutaneous larva migrans--but do not develop any further. Hookworm is the second most common human helminthic infection (after ascariasis) and among the most common chronic infections in the world, affecting around three quarters of a billion people in the tropics and subtropics, particularly in China and sub-Saharan Africa (deSilva et al. 2003). Hookworm species are worldwide in distribution, mostly in areas with moist, warm climates. Both N. americanus and A. duodenale are found in Africa, Asia, and the Americas. Necator americanus predominates in the Americas and Australia, while only A. duodenale is found in the Middle East, North Africa, and southern Europe.

Hookworms are transmiited to humans via contact with contaminated soil. Eggs are passed in the stool and under favorable conditions (moisture, warmth, shade), larvae hatch in 1 to 2 days.The released rhabditiform larvae grow in the feces and/or the soil and after 5 to 10 days (and two molts) they become filariform (third-stage) larvae that are infective. These infective larvae can survive 3 to 4 weeks in favorable environmental conditions. On contact with the human host, the larvae penetrate the skin and are carried through the blood vessels to the heart and then to the lungs.They penetrate into the pulmonary alveoli, ascend the bronchial tree to the pharynx, and are swallowed. The larvae reach the small intestine, where they reside and mature into adults. Adult worms live in the lumen of the small intestine, where they attach to the intestinal wall with resultant blood loss by the host. Most adult worms are eliminated in 1 to 2 years, but longevity may reach several years. Some A. duodenale larvae, following penetration of the host skin, can become dormant (in the intestine or muscle). In addition, infection by A. duodenale probably also occurs by the oral and transmammary route. Necator americanus, however, requires a transpulmonary migration phase. Iron deficiency anemia (caused by blood loss at the site of intestinal attachment of the adult worms) is the most common symptom of hookworm infection, and can be accompanied by cardiac complications. Gastrointestinal and nutritional/metabolic symptoms can also occur. In addition, local skin manifestations ('ground itch') can occur during penetration by the filariform (L3) larvae, and respiratory symptoms can be observed during pulmonary migration of the larvae.

(Primary source: Centers for Disease Control Parasites and Health Website)

Loukas et al. (2006) discussed the need for and prospects of developing a human hookworm vaccine. Hotez et al. (2004) provide a broad review of issues related to human hookworm infection.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Necator americanus is found in Africa, Asia, and Europe but is predominately found in the Americas and in Australia. In the United States, the largest concentration is found in the southern and southwestern United States. In the rest of the world, N. americanus is found in tropical climates.

Biogeographic Regions: nearctic ; palearctic ; oriental ; ethiopian ; neotropical ; australian

Other Geographic Terms: cosmopolitan

  • Behnke, J., D. Clercq, M. Sacko, F. Gilbert, D. Ouattara. 2000. The epidemiology of human hookworm infections in the southern region of Mali.. Tropical Medicine and International Health, 5 (No 5): 343-354.
  • Romstad, A., R. Gasser, P. Nansen, A. Polderman, N. Chilton. 1998. Necator americanus (Nematoda: Ancylostomatidae) from Africa and Malaysia have different ITS-2 rDNA sequences. International Journal of Parasitology, 28: 611-615.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

As a nematode, Necator americanus has a cylindrical body, and a cuticle with three main outer layers made of collagen and other compounds, secreted by the epidermis. The cuticle layer protects the nematode so it can invade digestive tracts of animals.

Eggs range in size from 65-75 micrometers x 36-40 micrometers and are virtually indistinguishable from those of Ancylostoma duodenale, another common hookworm. Necator americanus has four larval stages. The first stage is referred to as rhabditiform larvae because the esophagus has a large bulb separated from the rest of the esophagus by a region called the isthmus. The third stage is referred to as filariform larvae because the esophagus has no bulb. Adult females range in size from 9 mm to 11 mm while the smaller males range in size from 7 mm to 9 mm. The mouth of the adults has two pair of cutting plates, one dorsal and the other ventral. The males of the species are characterized by fused spicules found on the bursa. The common name "hookworm" comes from the dorsal curve at the anterior end.

Range length: 7 to 11 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Adult N. americanus are found exclusively in tropical and temperate regions. Eggs require a moist, warm and shaded environment to hatch. Optimal temperatures for juveniles to mature are from 23 to 30 deg C. Eggs and juveniles die below freezing or with soil dessication. Heavy rains and warmer temperatures appear to have a high positive correlation with the rate of transmission. Necator americanus appears to prefer male hosts to female hosts. However, this may be due to the division of labor in areas of high infestation. Soil type also plays a major part in the habitat for these worms. Ideal soil conditions are where the water drains but not too quickly. The pore size of the soil particle is a major factor.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Aquatic Biomes: lakes and ponds; temporary pools

Wetlands: marsh ; swamp

Other Habitat Features: urban ; suburban ; agricultural

  • Appleton, C., M. Maurihungirire, E. Gouws. 1999. The distribution of helminth infections along the coastal plain of Kwazulu-Natal province, South Africa.. Annals of Tropical Medicine & Parasitology, 93 (No.8): 859-868.
  • Roberts, L., J. Janovy, Jr. 2000. Gerald D. Schmidt & Larry S. Roberts’ Foundations of Parasitology, Sixth Edition. Boston: McGraw-Hill Companies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Adult N. americanus feed from the blood of their hosts. The worm will attach itself to the intestinal wall and use its cutting plates to cause bleeding. The worm feeds from this blood, possibly causing anemia to the host. Necator americanus does not permanently attach itself to the wall. This allows movement to new sites for feeding and reproduction within the host. Previous sites continue to bleed, adding the host's blood loss.

Animal Foods: blood; body fluids

Primary Diet: carnivore (Sanguivore , Eats body fluids)

  • Blaxter, M. 2000. Genes and genomes of Necator americanus and related hookworms. International Journal of Parasitology, 30: 347-355.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Necator americanus mainly infects humans and appears to prefer male hosts to female hosts. However, this may be due to the division of labor in areas of high infestation.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These parasites are probably not preyed on directly, but are ingested from host to host. Larval mortality is high as most of the parasites do not reach appropriate hosts.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Nematodes within the Secernentea have phasmids, which are unicellular glands. Phasmids likely function as chemoreceptors. Females may produce pheromones to attract males.

Nematodes in general have papillae, setae and amphids as the main sense organs. Setae detect motion (mechanoreceptors), while amphids detect chemicals (chemoreceptors).

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Necator americanus adults are obligate internal parasites of humans. Both the first and second stage rhabditiform larvae are free-living. Eggs are passed out through the feces of humans. These eggs will hatch within 2 days, and the first rhabditiform larva emerges. This larva will molt twice within 10 days to become a third stage filariform larva. The filariform larva will come into contact with the host's skin, and burrow into it. Travelling through the circulatory system to the lungs, the third stage larva will either be coughed up and swallowed or will migrate up the bronchi to the throat area. Once swallowed, the larva will make its way to the intestine. Upon reaching the intestine, the larva will molt twice and an adult will emerge. This adult will use its hooks to attach itself to the inner wall of the intestine and will cause hemorrhaging. The worm will feed from this blood. Mating occurs in the intestine. The eggs are the passed out with the feces.

  • Liu, C., Z. Xiaorong, Q. Dongchuan, X. Shuhua, P. Hotez. 1999. Epidemiology of human hookworm infection among adults villagers in Hejiang and Santai Counties, Sichuan Province, China. Acta Tropica, 73: 243-249.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The adult worms can live up to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sexual maturity is reached at the final molt. Egg production in females occurs five weeks or more after the female matures. Mating occurs in the intestine of the host.

Males are required to find females and inject their sperm into the females. Females may produce a pheromone to attract males. The male coils around a female with his curved area over the female genital pore. The gubernaculum, made of cuticle tissue, guides spicules which extend through the cloaca and anus. Males use spicules to hold open the genital opening on the female to allow transfer of sperm, which are amoeboid-like and lack flagella. The fertilized females then lay eggs in the surrounding areas. Females are capable of producing 10,000 eggs per day. The eggs are the passed out with the feces.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

There is no parental investment beyond egg laying.

Parental Investment: pre-fertilization (Provisioning)

  • Barnes, R. 1987. Invertebrate Zoology. Orlando, Florida: Dryden Press.
  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
  • Roberts, L., J. Janovy, Jr. 2000. Gerald D. Schmidt & Larry S. Roberts’ Foundations of Parasitology, Sixth Edition. Boston: McGraw-Hill Companies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Necator americanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTAATTTATATAAAAAATATCAGGGGGGTTTAGCTACTTGGTTGGAGAGTTCTAATCATAAGGATATTGGTACTTTGTATTTTTTGTTTGGTTTGTGATCTGGTATGGTAGGTACTAGTTTGTCTTTAATTATTCGTTTGGAGTTGGCTAAACCTGGTTTGTTGTTGGGAAATGGTCAGTTGTATAATTCTGCCATTACGGCGCATGCTATTTTGATGATCTTTTTTATGGTAATACCTAGTATAATTGGTGGTTTTGGTAATTGAATGTTACCTTTAATGTTGGGGGCTCCGGATATAAGTTTTCCTCGTTTAAATAATTTAAGTTTTTGGCTGTTACCTACTGCTATGTTTTTAATTTTAGATTCTTGTTTTGTTGATATAGGTTGTGGAACTAGTTGAACTGTTTATCCACCTTTAAGTACGTTGGGACATCCAGGTAGAAGTGTTGATTTGGCTATTTTTAGTTTACATTGTGCTGGTTTAAGTTCTATTTTAGGTGGTATTAATTTTATATGTACAACAAAAAATTTGCGTAGTAGATCTATTTCTTTAGAGCACATAAGTTTATTTGTGTGAACTGTTTTTGTTACGGTTTTTTTGTTGGTGTTATCTTTACCAGTTTTGGCTGGAGCTATTACTATGTTGTTAACTGATCGTAATTTAAATACTTCTTTTTTTGATCCAAGTACTGGTGGTAATCCGTTGATTTATCAGCATTTGTTTTGATTTTTTGGTCATCCTGAGGTTTATATTTTAATTTTGCCAGCATTTGGTATTATTAGGCAATCAACTTTATATTTAACTGGAAAAAAAGAAGTGTTTGGTTCTTTAGGTATAGTATATGCGATTCTAAGAATTGGTTTAATTGGTTGTGTAGTTTGAGCTCATCATATGTATACTGTTGGTATGGATTTGGATTCTCGAGCTTATTTTACTGCTGCTACGATAGTTATTGCTGTGCCTACAGGGGTTAAGGTTTTTAGTTGATTAGCTACAATATTTGGTATAAAAATGGTTTTTCAGCCTGTTTTGTTGTGAGTGTTGGGTTTTATTTTTTTATTTACTATTGGGGGTTTGACTGGTGTAATTTTATCAAATTCTAGGTTGGATATTATTTTACATGATACTTATTATGTTGTTAGTCATTTTCATTATGTTTTGAGGTTGGGTGCTGTTTTTGGTATTTTTACGGGTATTAGTTTGTGGTGAAGGTTTATAACAGGTTATGTTTATGATAAGTTGATAATATCTTCTGTTTTTTTTTTAATGTTTTTTGGTGTAAATTTGACTTTTTTTCCTTTGTATTTTGCTGGTTTACATGGTTTTCCTCGTAAGTATTTGGATTATCCTGATGTTTATTCAGTGTGAAATGTAATATCGTCTTATGGTTCTATGATTAGTGTTTTTGCTTTGTTTTTATTTTTGTATGTTTTGATTGAGTCTTTTTTTAGTTATCGTTTAGTTTTAAATGATAGTTTTATTAATAGTAGACCTGAGTATAGGTTAAGTAGTTATGTGTTTGGACATAGATATCAAAGAGAAATTTATTTTAGTTGTAGGGTTATTAAGTAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Necator americanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

None

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

As a strict parasite of humans, N. americanus has played a major role in the development of the New and Old worlds. Large numbers of worms cause what is known as "hookworm disease".

Nutrition and blood loss are the major contributors to ill effects from the interaction between host and parasite. The severity of the disease is directly related to the number of worms in the host's body. Each worm is capable of ingesting .03 ml of blood per day. When small amounts of worms have infected a host, the patient will be asymptomatic. Once infections reach 25 to 100 worms, the patient will experience light symptoms that include fatigue, slight weight loss, and possible headaches. Once infestations reach between 100-500 the patient will experience fatigue, iron deficiency leading to anemia, loss of appetite and abdominal pains. Should the infestation reach over 500, the patient will experience anemia and, depending on the diet of the person, possibly death. Children are at greater risks for lifelong damage and death due to their smaller size and greater need for nutrition. Generally infestation does not lead to death, but many cause permanent damage. The mortality rate for N. americanus is around .005% while the morbidity rate is 12%.

Treatment of N. americanus infections is simple, but resistance has been detected to usual treatments. Preventive measures include proper waste disposal, clean water, and proper footwear. Since the larvae need direct skin contact to invade the host, protective clothing is a key to maintaining low incidence rates.

Negative Impacts: injures humans (causes disease in humans )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Necator americanus

This article is about the organism. For the infection, see Necatoriasis.

Necator americanus is a species of hookworm (a type of helminth) commonly known as the New World hookworm. Like other hookworms, it is a member of the phylum Nematoda. It is a parasitic nematode that lives in the small intestine of hosts such as humans, dogs, and cats. Necatoriasis - a type of helminthiasis - is the term for the condition of being host to an infestation of a species of Necator. Since N. americanus and Ancylostoma duodenale (also known as Old World hookworm) are the two species of hookworms that most commonly infest humans, they are usually dealt with under the collective heading of "hookworm infection". They differ most obviously in geographical distribution, structure of mouthparts, and relative size.[1]

Necator americanus has been proposed as an alternative to Trichuris suis in helminthic therapy.[2]

Morphology[edit]

This parasite has two dorsal and two ventral cutting plates around the anterior margin of the buccal capsule. It also has a pair of subdorsal and a pair of subventral teeth located close to the rear. Males are usually 7-9 mm long, whereas females are about 9-11 mm long. The typical lifespan of these parasites is three to five years. They can produce between 5000 and 10,000 eggs per day.[3]

Life cycle[edit]

Life cycle of Necator americanus inside and outside of the human body

This worm starts out as an unembryonated egg in the soil. After 24–48 hours under favorable conditions, the eggs become embryonated and hatch. This first juvenile stage 1 is known as 'rhabditiform'. The rhabditiform larvae grow and molt in the soil, transforming into a juvenile stage 2. The juvenile stage 2 molts once more until reaching the juvenile 3 stage, which is also called 'filariform'; this is also the infective form. The transformation from rhabditiform to the filariform usually takes five to 10 days.[4] This larval form is able to penetrate human skin, travel through the blood vessels and heart, and reach the lungs. Once there, they burrow through the pulmonary alveoli and travel up the trachea, where they are swallowed and are carried to the small intestine, where they mature into adults and reproduce by attaching themselves to the intestinal wall, causing an increase of blood loss by the host. The eggs end up on the soil after leaving the body through the feces.[5] On average, most adult worms are eliminated in one to two years. The N. americanus life cycle only differs slightly from that of A. duodenale. N. americanus has no development arrest in immune hosts and it must migrate through the lungs.

References[edit]

  1. ^ Georgiev VS (May 2000). "Necatoriasis: treatment and developmental therapeutics". Expert Opin Investig Drugs 9 (5): 1065–78. doi:10.1517/13543784.9.5.1065. PMID 11060728. 
  2. ^ Croese J, O'neil J, Masson J, et al. (January 2006). "A proof of concept study establishing Necator americanus in Crohn's patients and reservoir donors". Gut 55 (1): 136–7. doi:10.1136/gut.2005.079129. PMC 1856386. PMID 16344586. 
  3. ^ Roberts, Larry S., and John Janovy, Jr. Foundations of Parasitology. Seventh ed. Singapore: McGraw-Hill, 2006. Print.
  4. ^ "hookworm." CDC. 2009. CDC Online. 4 Dec. 2009. <http://www.dpd.cdc.gov/dpdx/HTML/Hookworm.htm>.
  5. ^ "hookworm disease." Encyclopædia Britannica. 2009. Encyclopædia Britannica Online. 15 May. 2009 <http://www.britannica.com/EBchecked/topic/271350/hookworm-disease>.

Further reading[edit]

  • Hotez,P.J.,and D.I.Pritchard.1995(June).Hookworm infection.Sci. Am. 272:68-74.
  • Murray,P.R.,K.S.Rosenthal,and M.A.Pfaller.2009.Medical Mirobiology,6th ed.Elsevier/Mosby Publishing Company,Philadelphia, U.S.A.,865 p.
  • Schmidt,G.D.,and L.S.Roberts.2009.Foundations of parasitology,8th ed.McGraw-Hill Companies,New York,p. 472-473.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!