Overview

Distribution

In Panama this species has been collected from the Pearl Islands Archipelago (depth 8 m), Gulf of Panama and off Coiba Island (USNM E 7598, USNM E 7599, USNM E 7600), Gulf of Chiriqui, eastern Pacific, North Pacific Ocean.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

References and links

Gray, J.E. (1840). A synopsis of the genera and species of the class Hypostoma (Asterias Linnaeus). Annals of the Magazine of Natural History 6: 175-184; 275-290.

World Asteroidea Database

LSID urn:lsid:marinespecies.org:taxname:370899


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Synonymised taxa

Oreaster hawaiiensis (Fisher, 1906) (Synonym according to Doderlein (1936))
Oreaster occidentalis Verrill, 1870 (Synonym according to Doderlein (1936))
Pentaceros cumingi Gray, 1840
Pentaceros hawaiiensis Fisher, 1906 (Synonym according to Doderlein (1936))
Pentaceros occidentalis (Verrill, 1870)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Coppard , Simon

Source: The Echinoderms of Panama

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Pentaceros hawaiiensis Fisher, 1906
Catalog Number: USNM 21171
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1902
Locality: Molokai Island, Moku, Hawaii, United States, North Pacific Ocean
Depth (m): 79 to 121
Vessel: Albatross R/V
  • Holotype: Fisher. 1906. Bull. U.S. Fish. Commn. 3: 1072-1074, pl.32, figs.1-3, pl.33, fig.1, pl.34, fig.3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pentaceros hawaiiensis Fisher, 1906
Catalog Number: USNM 31949
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1902
Locality: Molokai Island, Moku, Hawaii, United States, North Pacific Ocean
Depth (m): 79 to 121
Vessel: Albatross R/V
  • Paratype: Fisher. 1906. Bull. U.S. Fish. Commn. 3: 1072-1074, pl.32, figs.1-3, pl.33, fig.1, pl.34, fig.3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pentaceros hawaiiensis Fisher, 1906
Catalog Number: USNM 31948
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1902
Locality: Molokai Island, Moku, Hawaii, United States, North Pacific Ocean
Depth (m): 79 to 134
Vessel: Albatross R/V
  • Paratype: Fisher. 1906. Bull. U.S. Fish. Commn. 3: 1072-1074, pl.32, figs.1-3, pl.33, fig.1, pl.34, fig.3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pentaceros hawaiiensis Fisher, 1906
Catalog Number: USNM 32199
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): United States Fish Commission
Year Collected: 1902
Locality: Molokai Island, Moku, Hawaii, United States, North Pacific Ocean
Depth (m): 79 to 134
Vessel: Albatross R/V
  • Paratype: Fisher. 1906. Bull. U.S. Fish. Commn. 3: 1072-1074, pl.32, figs.1-3, pl.33, fig.1, pl.34, fig.3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Pentaceros hawaiiensis Fisher, 1906
Catalog Number: USNM 31302
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): United States Fish Commission
Year Collected: 1902
Locality: Molokai Island, Moku, Hawaii, United States, North Pacific Ocean
Depth (m): 79 to 134
Vessel: Albatross R/V
  • Paratype: Fisher. 1906. Bull. U.S. Fish. Commn. 3: 1072-1074, pl.32, figs.1-3, pl.33, fig.1, pl.34, fig.3.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 8 - 31
  Temperature range (°C): 20.900 - 23.430
  Nitrate (umol/L): 1.356 - 10.745
  Salinity (PPS): 34.829 - 35.000
  Oxygen (ml/l): 3.753 - 4.766
  Phosphate (umol/l): 0.568 - 1.100
  Silicate (umol/l): 5.633 - 10.364

Graphical representation

Depth range (m): 8 - 31

Temperature range (°C): 20.900 - 23.430

Nitrate (umol/L): 1.356 - 10.745

Salinity (PPS): 34.829 - 35.000

Oxygen (ml/l): 3.753 - 4.766

Phosphate (umol/l): 0.568 - 1.100

Silicate (umol/l): 5.633 - 10.364
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oreaster occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGACGATGATTCTTTTCAACCAAACACAAGGACATAGGAACCCTATATCTAATATTCGGAGCCTGAGCAGGAATGGTCGGAACTGCAATGAGAGTAATAATACGAACAGAACTCGCCCAACCAGGATCCCTCCTTAAAGAC---GACCAGATCTACAAAGTAATAGTAACCGCGCACGCCTTAGTGATGATATTTTTCATGGTAATGCCAATTATGATTGGCGGGTTCGGAAACTGGCTAATTCCCCTTATGATTGGAGCACCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGATTTTGACTTGTACCCCCATCATTCCTTCTACTAATCGCCTCCGCCGGGGTAGAAAGGGGAGCCGGAACCGGCTGAACCATATACCCCCCACTATCGAGTGGCCTAGCCCATGCAGGGGGGTCTGTTGACCTAGCCATATTCTCCTTACACTTAGCAGGAGCCTCATCAATCCTTGCATCCATAAAATTCATAACCACGGTAATAAAAATGCGAACGCCAGGCATCTCCTTTGACCGGCTGCCACTGTTCGTGTGATCAGTATTCGTAACAGCATTCCTACTCCTGCTATCACTCCCAGTCCTGGCAGGAGCAATAACAATGCTACTTACCGACCGAAAAGTAAAAACGACATTCTTCGACCCCGCTGGAGGAGGTGACCCCATTCTATTTCAACACCTATTTTGATTCTTTGGCCACCCAGAGGTATACATCCTTATACTCCCCGGATTCGGCATGATTTCCCAAGTAATAGCCCACTACTCAGGTAAGAGGGAGCCATTCGGCTACTTAGGAATGGTCTACGCCATAGTATCCATAGGCATCCTAGGATTCTTAGTTTGAGCGCATCACATGTTCACGGTAGGAATGGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oreaster occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pentaceraster cumingi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!