Overview

Comprehensive Description

The Amethyst Gem Clam (Gemma gemma) is a tiny, somewhat triangular clam (usually less than 3mm) with a smooth, glossy shell. The inner shell has a finely scalloped margin (visible with a hand lens). Shell color is whitish or gray, often tinted with purple. (Morris 1973; Gosner 1978; Kozloff 1993) This clam is an Atlantic species introduced into Pacific waters. It lives in soft mud and is therefore found on muddy beaches. The short siphons never extend more than a few millimeters beyond the end of the shell. (Narchi 1971)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belize, Caribbean Sea, Cobscook Bay, Colombia, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Mexico, North West Atlantic, Puerto Rico, Venezuela
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence (unspecified region), southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle valley), downstream part of middle St. Lawrence estuary, Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), lower St. Lawrence estuary, Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands), lower North Shore; western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Nova Scotia to Florida, Texas and the Bahamas; Puget Sound, Washington (introduced)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Amethyst Gem Clam (Gemma gemma) is found from Nova Scotia to Texas and is often common, although easily overlooked due to its tiny size (Morris 1973; Gosner 1978). It was introduced from the Atlantic to the Pacific coast, where it is now common in muddy situations in a number of bays (Abbott 1968; Kozloff 1993). Carlton (1992) reported that on the Pacific coast this clam was restricted to 5 bays in central California (Bodega Harbor (not Bodega Bay), Tomales Bay, Bolinas Lagoon, San Francisco Bay, and Elkhom Slough). Grosholz (2005) documented a dramatic increase in the distribution and abundance of Gemma gemma in Bodega Harbor, where it has been present since at least the 1960s. This clam was first introduced to the western U.S. in the late 1800s by means of the oyster trade (Carlton 1999, cited in Grosholz 2005).

Gemma gemma is an Atlantic species, occurring from Nova Scotia to Florida, Texas, and the Bahamas. It occurs on the west coast of the United States as well, from Puget Sound to San Diego, including the shores of San Francisco Bay, having been introduced from Chesapeake Bay (Maryland, U.S.A.) around1899. (Narchi 1971 and references therein)

The northern limit of the range of G. gemma is Labrador or Nova Scotia, but the southern limit is less certain as a result of taxonomic confusion with G. purpurea. Gemma gemma certainly occurs as far south as Cape Hatteras, where it is predominantly subtidal. In Chesapeake Bay (Maryland) and Raritan Bay (New Jersey), the species is partly subtidal and partly intertidal, while on the north side of Cape Cod and in Sagadahoc Bay (Maine), it is entirely intertidal. High summer temperatures are likely an important factor limiting this clam's distribution. (Green and Hobson 1970 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Detailed accounts of the internal anatomy of Gemma gemma can be found in Sellmer (1967) and Narchi (1971). The shell of Gemma gemma is small, subtrigonal, moderately inflated and rather thin. The exterior is polished and has numerous fine concentric riblets. There are three teeth in the left valve and two teeth in the right (this seems to have been reversed in error in Sellmer 1967). Color is whitish to tan, with purplish over the beak and posterior areas. The animals may be so abundant along the coast of New England that the beaches appear purple, due to the many shells. The shell may reach 5.0 mm long, 4.5 mm high, and 3.0 mm wide, but is usually half this size. Several authors have noted the alga Enteromorpha [now in Ulva: Hayden et al. 2003] attached to the posterior region of the shell. Algal growth is confined to the siphonal region because the animal is buried so that the posterior part of the shell and siphons are exposed. Near the tips of the siphons, irregular patches and streaks of reddish brown pigment occur on the outer surface. Elsewhere the siphons are smooth creamy white, due to opaque white patches on the inner surfaces, which shine through the tissues. The siphons are fused along as much as half their lengths and their tentacles are well developed. There is a ring of simple tentacles surrounding the inhalant aperture. The tentacles are of two alternating sizes. The inhalant siphon bears 8 to 12 tentacles which are loosely interdigitated over the opening when the animal is pumping water. The exhalent siphon in both species has a thin semitransparent sleeve, the valvular membrane, which is an extension of the siphon. The foot and siphons may be withdrawn quickly when the animals are disturbed. When this occurs, the valvular membrane is drawn into the inside of the base of the exhalent siphon. When the animal is undisturbed, the siphons protrude slowly without showing the valvular membrane; then suddenly with explosive force the valvular membrane is extruded. The foot is well developed, wedge-shaped, and adapted to burrowing. It can be extended to a distance approximately equal to the length of the shell. The tip has considerable mobility, moving readily and quickly. When placed flat on the surface of the sand, the animal disappears into the substratum in a minute or less. (Narchi 1971 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Gemma fretensis Rehder, 1939
Catalog Number: USNM 508650
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): H. Townes
Locality: Long Island Sound at Crab Meado State Park, New York, United States, North Atlantic Ocean
  • Holotype: N. 53(1): 18, pl. 6, fig. 8,9.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Cyrena purpurea Lea, 1842
Catalog Number: USNM 87551
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): H. Lea
Locality: United States, Delaware Bay, North Atlantic Ocean
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Lookalikes

Kozloff (1993) notes that on the Pacific coast Gemma gemma can be confused with tiny clams in the genus Transennella, but Transennella lacks the fine scalloping on the inner margin of the shell.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 474 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): -99 - 66
  Temperature range (°C): 9.208 - 26.658
  Nitrate (umol/L): 0.457 - 3.829
  Salinity (PPS): 32.282 - 36.130
  Oxygen (ml/l): 4.583 - 6.764
  Phosphate (umol/l): 0.085 - 0.547
  Silicate (umol/l): 0.868 - 2.666

Graphical representation

Depth range (m): -99 - 66

Temperature range (°C): 9.208 - 26.658

Nitrate (umol/L): 0.457 - 3.829

Salinity (PPS): 32.282 - 36.130

Oxygen (ml/l): 4.583 - 6.764

Phosphate (umol/l): 0.085 - 0.547

Silicate (umol/l): 0.868 - 2.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Amethyst Gem Clam (Gemma gemma) is found in muddy or sandy tidal flats or subtidally at shallow depths in salinities as low as 5 parts per thousand (Gosner 1978; Rehder 1981) (salinity in the Atlantic Ocean is typically around 35 parts per thousand).


These tiny clams live in the intertidal zone buried in a depth of two centimeters in sand or muddy sand (Narchi 1971).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Grosholz (2005) provided evidence that the rapid increase in G. gemma in recent decades in Bodega Harbor, California, is the result of the introduction of the European Green Crab (Carcinus maenas), which is believed to have been first introduced to the western U.S. in San Francisco Bay around 1989. It became established outside of San Francisco Bay in nearby estuaries, including Bodega Harbor, by 1994 and is now common in bays and estuaries from Monterey Bay, California, to Gray’s Harbor, Washington. The positive impact of this introduced crab on the introduced Gemma gemma seems to be mediated by the crab's disproportionate negative impact on native Nutricola clams, which apparently previously suppressed Gemma gemma through competitive interactions. Grosholz presents this interaction as an example of how a new invader can transform an older invader into a serious new management problem by means of positive indirect interactions that may produce an invasional meltdown (Grosholz 2005).

Reported predators of Gemma gemma on the Atlantic coast include the horseshoe crab Limulus polyphemus and the sand shrimp Crangon septumspinosa (Green and Hobson 1970 and references therein).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Gemma gemma often reaches densities of 105 per square meter in relatively protected, shallow, sandy sediments along the Atlantic coast of North America (Green and Hobson 1970). See Green and Hobson (1970) for a thorough study of the population structure and dynamics of Gemma gemma around Barnstable, Massachusetts (U.S.A.).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Amethyst Gem Clam sexes are separate. The fertilized eggs develop within the female's mantle (the fleshy outer structure covering a mollusk's vital organs and usually containing glands that secrete the shell). The young hatch and leave the mother's shell to burrow into mud or sand. (Green and Hudson 1970; Rehder 1981). In California, Narchi (1971) found animals brooding juveniles in the gills in February, March, and April.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gemma gemma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTTTATATATAATTTTTGCTTTTTGGTGTGGGTTGATAGGTACTGCTTTTAGAGTTATTATTCGTATAGAACTATCTATACCAGGAACTATTTTAGATGAC---GCTCAATTATATAATTTGATTGTTACTTCACATGGGTTAGTAATAATTTTTTTTTTAGTGATGCCTATAATAATTGGAGGTTTTGGTAATTGATTAGTTCCTTTAATATTAACTGCACCAGATATGGCTTATCCTCGAGTAAATAATTTGAGTTTTTGGTTGTTAATAGTTTCAGTTATATTATTTTTAGGTTCTGCTTATGTGGATGCTGGAGCTGGGACTGGATGAACTCTTTATCCTCCTTTAACTAGATCAAAGTTCCATTCTGGAGTATCTGTAGATTATTTAATTTTATCGTTACATGTGGGTGGGGCCTCTTCTATTATGTCTTCTATTAATTTTGCTGCTACTGGATTATGTATACGTCCTGAAATTATAATTATACCTCGAACTACTATATTTGTTTGATGTGTTTGTGTTACTGGATTTTTATTATTATGTGCTATGCCAGTTTTAGCTGCTGCTTTAACTATATTAATTACAGATCGAAATTTTAATACTACTTTTTTTGATCCTTTAGGTTTAGGTGATCCTTTACTTTTTGTTCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gemma gemma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Amethyst gem clam

The amethyst gem clam, Gemma gemma, is species of very small saltwater clam, a marine bivalve mollusk in the family Veneridae, the Venus clams.

This is a small species, reaching a length of only 5 mm.[1] The shell color is whitish or grayish, suffused with purple on both outer and inner surfaces.

This species is native to the Atlantic coast of North America, from Labrador to Texas,[2] but it is now also found as an introduced species in some locations on the Pacific coast.[3]

References

  1. ^ Sellmer, G P (1967). "Functional morphology and ecological life history of the gem clam, Gemma gemma (Eulamellibranchia: Veneridae)". Malacologia 5: 37–233. 
  2. ^ Global Invasive Species Database. "Gemma gemma (mollusc)". Retrieved 11 February 2011. 
  3. ^ Kaustuv R, D Jablonski & J W Valentine (2001). "Climate change, species range limits and body size in marine bivalves". Ecology Letters 4 (4): 366–370. doi:10.1046/j.1461-0248.2001.00236.x. Retrieved 11 February 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!