Molecular Biology and Genetics

Molecular Biology

Barcode data: Venerupis philippinarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 100 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAGCGGTGGTTTTTAAGGACTAACCATAAGGACATTGGTACTATATATTTTATATTCTCTATTTGGTCTGGCCTCATAGGAACAGGTCTTAGAATTATTATTCGTATAGAGCTTGCGATACCTGGTAAAATATTGGAAGAT---GGTCAATTATACAATTTGGTAGTGACCGCCCATGGATTGGTAATAATTTTCTTTTTAGTTATGCCTATAATAATTGGGGGTTTCGGTAATTGGCTTATTCCATTAATGTTGAAAATTCCCGATATGGCTTTTGCACGAATAAATAACTTAAGTTTTTGGTTATTAATAGGTTCCATAATTTTGTTGTTGGGTTCTACTTATGTAGATGGTGGGGCTGGAACTGGATGAACTATCTATCCGCCGTTATCCTCTATTGGGTATCATTCGGGGCGAGCGGTGGATTTTTTAATTTTTTCTTTACACGCGGGGGGTGTGTCATCTATTTTAGCATCTATTAATTTTTTAATTACTACAGCTTTAATGCGGACAGGAGTTATGCTCATTCTTCGTAGTAGAATGTTAAGGTGATGTTTAGGTGTGACTAGATTTCTTCTGGTAGTAGCCATACCAGTACTAGCAGGAGGGTTGACGATGCTTTTATTCGATCGACACTTCAATACGACTTTTTTTGACCCTGTTGGGTTGGGGGACCCTATTTTGTTTATTCACTTATTTTGGTTTTTTGGTCACCCTGAAGTGTATATCTTAATTCTACCTGCTTTTGGAATTATCTCCCATGTAGTAAAAGCAGGGAGGTCAAAATTACAACTGTTTGGTAAAATTCCTATAATGCACGCTGTCACCTCTATTGGGTTTTTAGGGTTTATTGTGTGGGGTCATCACATGTTTACAGTTGGGATGAATGTAGATAGTCGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Venerupis philippinarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 95
Specimens with Barcodes: 107
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Ruditapes philippinarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ruditapes philippinarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Venerupis philippinarum

Venerupis philippinarum is an edible species of saltwater clam, a marine bivalve mollusk in the family Veneridae, the Venus clams.

The common names of the species include "Asari" (after its Japanese name), "Japanese littleneck", "Manila clam", "steamer clam", "Filipino Venus", "Japanese cockle", and "Japanese carpet shell".

Description[edit]

The shell of Venerupis philippinarum is elongate, oval, and sculptured with radiating ribs (Morris, 1980). It grows to 7.5 cm (3.0 in) across and 3.5 cm (1.4 in) in width. The color is highly variable: it is commonly grayish, greenish, brownish, yellow or buff with distinct dark or light colored, with triangular mottled markings that begin at the umbo and disperse outwards. The true color can be distorted by dark gray staining, caused by anoxic mud.[citation needed] The foot of live specimens is an orange color.

The features most diagnostic for the identification of this species are the following: that the inner ventral margin of the shell is smooth; the ligament is prominent and elevated above the dorsal margin. In the living animal, the siphons are separated at the tips (Carlton, 2007). Water is drawn in and out of a clam by siphons that protrude from the posterior end of the shell. In this species, the siphons are mostly fused, and are only separate at the tips. The siphons are short relative to some other clams, which means that the clam lives burrowed only a shallow distance under the surface of the substrate. Short siphons are what inspire the common name “littleneck clam”.[citation needed]

Possible misidentifications[edit]

In western North America, this species is often confused with Protothaca staminea,[citation needed] however, V. philippinarum shells are more elongate than P. staminea. Internally, V. philippinarum has yellowish valves, with a purple suffusion near the posterior margin. Protothaca staminea lacks this purple suffusion. This species may be found together with Protothaca staminea, but tends to reside at slightly higher tide levels.[citation needed]

Habitat[edit]

This species is native from southern Siberia to China. It was introduced to the West Coast of North America with oyster spat from Japan and now occurs from the British Columbia Coast to the Central Coast of California and Marina del Rey. It lives from the mid to low intertidal zone in bays and estuaries, in mud, sandy mud and cobble, buried 2–4 cm (0.79–1.57 in) below the surface. Common in the Philippines, hence its species name.

Life history[edit]

Miso soup made of Japanese littleneck clams (Asari).

V. philippinarum breeds in the summer. Larvae then continue to grow slowly (especially in areas of crowding),[citation needed] reaching maturity at 1–2 cm (0.39–0.79 in), and will live from 7–10 years. A non-native species, V. philippinarum was introduced during the 1930s, brought over from Japan with oyster spat from Japanese oysters. It is now extremely common amongst the Pacific coast, and is highly prized for food (Morris, 1980). V. philippinarum is also capable of withstanding salinities as low as 30-50 percent of that of pure seawater, and can tolerate levels of high pollution.[citation needed]

Predators[edit]

Predators include moon snails (Euspira lewisii), the Atlantic oyster drill (Urosalpinx cinerea), Dungeness crab (Metacarcinus magister), red rock crab (Cancer productus), bat rays (Mylobatus californicus), flounder, sturgeon, willet (Catoptrophorus semipalmatus), ring billed gulls (Larus delawarensis) and raccoons (Procyon lotor) among others.

References[edit]

  • Carlton, J. T. (2007). The light and smith manual intertidal invertebrates from Central California to Oregon. Berkeley and Los Angeles, CA: University of California Press
  • Cohen, Andrew (2005). Guide to the exotic species of San Francisco Bay. Retrieved June 7, 2005, from http://www.exoticsguide.org/species_pages/v_philippinarum.html
  • Dudas, S.E., McGraw, I.J., & Dower, J.F. (2005). Selective crab predation on native and introduced bivalves in British Columbia. Journal of Experimental Marine Biology and Ecology. 325, 8-17
  • Hanby, B (2005). Marine life of the Pacific northwest. Madeira Park, BC: Harbour Publishing.
  • Kozloff, E (1993). Seashore life of the northern Pacific coat. Seattle, Wa: University of Washington Press
  • Mihele, M. (2007).Predatory behavior and preference of a successful invader, the mud crab Dyspanopeus sayi (Panopeidae), on its bivalve prey. Journal of experimental marine biology and ecology. 312, 385-398
  • Morris, R.H., Abbott, D.P., & Haderlie, E.C. (1980). Intertidal invertebrates of California. Stanford, CA: Stanford University Press
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!