Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

Biology

Horseshoe crabs are typically active at night, with activity peaking around the time of the full moon. They dig for food, such as worms, algae and molluscs in the sediment (3). During the spring and summer, adults migrate in huge numbers towards sandy beaches and congregate in the shallow water (4). Breeding is associated with the lunar and tidal cycles, with most adults arriving at the full or new moon and within a couple of hours of high tide. The direction of the waves guides the females towards the beach (3). Males patrol along the bottom of the beach in the shallow water, waiting to intercept beach-bound females (4). Pairs make their way to the high tide mark and the male fertilises the eggs as they are laid into a 15 centimetres deep nest in the sand (3). From 2,000 to 20,000 eggs may be produced in a single clutch (4). Very often there may be more than one male accompanying each female; in some cases there have been as many as 14 males to one female. As the tide begins to retreat, the horseshoe crabs make their way back to the sea (3). The sticky eggs hatch after around five weeks (3), but this is dependent on temperature (4). The larvae, which are known as 'trilobite' larvae may remain buried in the sand in aggregations for a number of weeks (4) before emerging at high tide. After they enter the water, they undergo a 'swimming frenzy' of constant, vigorous activity. Six to eight days after emerging, they moult into the first juvenile stage, which is very similar in appearance to the adult stage. At this point they cease swimming and start to live on the bottom (3). Horseshoe crabs are slow-growing. Males reach sexual maturity at 9 to 11 years of age and females between 10 to 12 years. Although it is difficult to assess age in this species, the average life-span is thought to be 20 to 40 years (4). The horseshoe crab is an essential part of the ecosystem in which it occurs. Their eggs provide a valuable source of food for many species including wading birds, sea turtles, alligators and fish. Furthermore, the action of the crab as it ploughs the sea bed in search of food aerates the substrate, resulting in a higher level of species richness (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The horseshoe crab is a 'living fossil': forms almost identical to this species were present during the Triassic period 230 million years ago, and similar species were present in the Devonian, a staggering 400 million years ago (3). Despite their common name, they are not crabs but are related to arachnids (spiders, scorpions, ticks and mites) (4), and are the closest living relatives of the now extinct trilobites (3). Horseshoe crabs have three main parts to the body: the head region, known as the 'prosoma', the abdominal region or 'opisthosoma' and the spine-like tail or 'telson' (2). It is the tail that earns this order its name Xiphosura, which derives from the Greek for 'sword tail' (4). The sexes are similar in appearance, but females are much larger than males (2). The carapace is shaped like a horseshoe, and is greenish grey to dark brown in colour. A wide range of marine species become attached to the carapace, including algae, flat worms, molluscs, barnacles and bryozoans, and horseshoe crabs have been described as 'living museums' due to the number of organisms that they can support (3). On the underside of the prosoma there are six paired appendages, the first of which (the chelicera) are used to pass food into the mouth. The second pair, the pedipalps are used as walking legs; in males they are tipped with 'claspers' which are used during mating to hold onto the female's carapace. The remaining four pairs of appendages are the 'pusher legs', also used in locomotion. The opisthosoma bears a further six pairs of appendages; the first pair houses the genital pores, while the remaining five pairs are modified into flattened plates, known as book gills, that are used in 'breathing' (4). There is a compound eye on each side of the prosoma, five eyes on the top of the carapace, and two eyes on the underside, close to the mouth, making a total of nine eyes. In addition, the tail bears a series of light-sensing organs along its length (2). A further unique and intriguing feature of this ancient species is that it has blue copper-based blood (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The horseshoe crab, Limulus polyphemus, is more closely related to chelicerates such as spiders, scorpions, ticks and mites than it is to true crabs and other crustaceans. Horseshoe crabs are considered to be "living fossils" that have evolved little in the past 250 million years. Limulus is an ancient genus which has probably existed since the Silurian period (440 to 410 million years ago), and shows little morphological change from the now extinct genus Paleolimulus that lived about 200 million years ago. Limulus polyphemus is believed to be the closest living relative of trilobites (Shuster 1982).Like all chelicerates, members of the Order Xiphosurida have a two-part body consisting of a prosoma, or head region; and an opisthosoma, or abdominal region. The prosoma contains 6 pairs of legs, all of which bear claws except the last pair. The prosoma also contains 2 types of eyes: 2 compound eyes, or ommatidia, are located on either side of the head; and 2 simple eyes, or ocelli, are located in the center of the head. The opisthosoma contains an additional 6 pairs of appendages which aid in respiration, reproduction, and locomotion. The first pair of abdominal appendages form a genital operculum which houses the genital pores. The remaining 5 pairs of appendages are modified into a series of overlapping plates which function as gills. The underside of each plate is highly folded into leaf-like folds, or lamellae, which provide the actual surface for gas exchange. Due to their morphology, the abdominal plates have become known as book gills. In addition to their respiratory function, the opisthosomal appendages also function as paddles in locomotion. A long spine, called a telson, is located behind the opisthosoma and gives this order its name: Xiphos being Greek for "sword", and uros meaning "tail."
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Along the Atlantic Coast, from Nova Scotia to the Yucatan.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range

This species is found along the east coast of North America from Maine through south Florida and the Gulf of Mexico to the Yucatan Peninsula. Along this range there are distinct populations, with the largest population in Delaware Bay (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range Description

Found on the east coast of North America from Nova Scotia (Canada) south to the Yucatan Peninsula (Mexico).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Maine to Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

German Bight, Gulf of Maine, North East Atlantic, North West Atlantic, West North Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Limulus polyphemus is distributed geographically from approximately 19° N to 42° N along the east coast of North America from Maine through south Florida and the Gulf of Mexico to the Yucatan peninsula, with peak abundance in Delaware Bay (Botton and Ropes 1987). Distinct populations occur along this range (Shuster 1982). Limulus polyphemus is found in all three water bodies of the Indian River Lagoon (Indian River, Banana River, Mosquito Lagoon). The greatest abundance of horseshoe crabs in the India River Lagoon is found in the northern Indian River, southern Banana River, and southern Mosquito Lagoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Horseshoe crabs are long-lived and slow to mature in comparison to most other invertebrate groups. Males reach sexual maturity between 9 - 11 years of age, and females between 10 - 12 years of age (Cohen and Brockmann 1983). The average life span is believed to be approximately 20 - 40 years; however, it is difficult to accurately assess age in horseshoe crabs (Botton and Ropes 1988). The adult size of Limulus polyphemus shows a distinct latitudinal gradient, with larger animals found toward the center of the range, and smaller animals found at the extremes of the range, north of Cape Cod, along the Florida coast, and in the Gulf of Mexico. Limulus polyphemus shows distinct sexual dimorphism, with males approximately 1/3 the size of the females (Shuster 1982). Adult females in the Indian River Lagoon have an average prosomal width of 189 mm, while the average adult male has a prosomal width of 136 mm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The horseshoe crab can generally be found in shallow water, over sandy or muddy bottoms.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 921 specimens in 1 taxon.
Water temperature and chemistry ranges based on 400 samples.

Environmental ranges
  Depth range (m): 0 - 303.5
  Temperature range (°C): 7.337 - 24.310
  Nitrate (umol/L): 0.327 - 13.432
  Salinity (PPS): 32.426 - 36.472
  Oxygen (ml/l): 3.840 - 6.494
  Phosphate (umol/l): 0.119 - 0.832
  Silicate (umol/l): 1.081 - 7.879

Graphical representation

Depth range (m): 0 - 303.5

Temperature range (°C): 7.337 - 24.310

Nitrate (umol/L): 0.327 - 13.432

Salinity (PPS): 32.426 - 36.472

Oxygen (ml/l): 3.840 - 6.494

Phosphate (umol/l): 0.119 - 0.832

Silicate (umol/l): 1.081 - 7.879
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The horseshoe crab dwells on the bottom of muddy and sandy bays and estuaries. In the Gulf of Mexico, individuals have been found down to depths of 30 metres, with concentrations at five to six metres (3). They require sloping sandy beaches on which to lay their eggs (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The horseshoe crab feeds at night on worms, small molluscs, and algae. Food is picked up by the chelicerae and passed back to the bristle bases, where it is "chewed." The food is then moved forward to the mouth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The larvae of horseshoe crabs are non-feeding. Upon the molt to the first juvenile instar, feeding behavior is initiated (Rudloe 1980). The diet of immature and adult L. polyphemus includes bivalve mollusks and Polychaete worms such as Cerebratulus, Nereis, and Cistenides (Shuster 1982). To feed, L. polyphemus typically digs its food from sediments, grasping the prey with its legs. The prey is moved to the gnathobases where it is crushed before being pushed forward toward the mouth (Shuster 1982).Habitat:L. polyphemus spends most of its life in the subtidal zone, except for annual spawning migrations (Botton and Ropes 1987). Horseshoe crabs require a sloping sandy beach upon which to lay their nests. Horseshoe crabs in Florida (Rudloe 1980) and Massachusetts (Barlow et al. 1986) nest in a narrow band in the upper middle quarter of the beach, whereas crabs in the Delaware Bay nest in a wide band over most of the beach (Botton et al. 1992, Shuster and Botton 1985). Botton et al. (1988) suggests that even subtle alteration of sediment may affect the suitability of the habitat for horseshoe crab reproduction.Activity Time: Larvae of L. polyphemus remain buried in the sand during daylight hours, and Rudloe (1979) found that larval activity begins suddenly near the same hour each evening and terminates abruptly near the same hour each morning. This finding suggests that larval activity may be triggered very precisely by some environmental factor such as light intensity. After the molt to the juvenile stage, Limulus ceases the nocturnal swimming characteristic of trilobite larvae (Rudloe 1979) and becomes a benthic animal that alternatively crawls at the surface of the substratum and buries itself in the sand (Rudloe 1981). Both adults and juveniles demonstrate a diurnal activity pattern. However, while adults can be active during the evening, juveniles tend to bury themselves at night.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

The carapaces of L. polyphemus adults are suitable habitat for a number of species. Most of the sessile organisms that colonize Limulus also attach to other hard surfaces in the environment (Shuster 1982). Several species of algae and protozoa, as well as bryozoans, coelenterates, annelids, barnacles, and tunicates are typical colonizers of Limulus carapaces.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Population sizes of Limulus polyphemus show a distinct latitudinal gradient, with the largest population centers found in the central portion of the distributional range along the mid-Atlantic coast of the United States, especially in the Delaware Bay region of New Jersey. Population size decreases north of Cape Cod, along the Florida coast, and in the Gulf of Mexico (Botton and Ropes 1987).Locomotion: Adults and juvenile L. polyphemus use crawling as their primary means of locomotion. Horseshoe crabs also commonly bury themselves under the surface of the sand (Rudloe 1981). Occasionally a horseshoe crab will turn onto its back and swim upside-down, using its book gills to propel itself through the water (Shuster 1982). Larvae of this species, when first emerging from nests or when first exposed to water, exhibit a "swimming frenzy" similar to that of neonate sea turtles, swimming vigorously and continuously for hours (Rudloe 1980). Despite the possibility for wide dispersion during their free-swimming period, many larvae have been shown to settle in shallow waters near the beaches where they were spawned (Shuster 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

The first pair of the six, flap-like appendages on the underside of the abdomen acts as a cover for the genital pore. The egg or sperm are released through this pore during spawning.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Limulus polyphemus is generally dispersed sub-littorally, but spawns on sandy beaches. The movement of mature Limulus to spawning areas is most likely triggered by a sensory system which detects seasonal changes in light patterns (Shuster 1982). Horseshoe crabs spawn during the spring and early summer on beaches along the Atlantic and Gulf coasts of the United States, and in Yucatan, Mexico (Penn and Brockmann 1994). In spring, Limulus males, which often outnumber females many times over, patrol along the foot of the beach awaiting females. Females move from deeper water directly to the beach where they nest. This directional movement of males and females, along with the numbers of males involved, reduces the likelihood of females reaching the beach without becoming paired (Shuster 1982). Horseshoe crabs typically locate mates, achieve amplexus, then migrate to the high tide mark in the intertidal zone to deposit and fertilize eggs before returning to deeper water after the spawning season. When waters are calm, many males may cluster around individual females, and large spawning assemblages can occur. Under rough conditions, only one or two males are able to grasp onto a female while also avoiding being washed away. Rough waters may drive spawning horseshoe crabs off beaches, or may keep them from moving onto the beach entirely (Shuster 1982). While nesting, females bury themselves in the sediment near the water's edge and lay a series of discrete egg clusters, each containing 2,000-20,000 eggs (Brockmann 1990). These eggs are fertilized by sperm released by an attached male and by one or more satellite males that typically congregate around the nesting pair (Rudloe 1980).The reproductive cycle of horseshoe crabs has been found to be related to lunar activity in some areas. In one Florida study, Rudloe (1980) found that breeding in adults and hatching of larvae in Apalachee Bay, Florida was most prevalent on spring nights at the full moon. However, in St. Joseph Bay, FL spawning peaks occurred at the first and last quarter moons rather than around the new and full moons. This observation lead Rudloe (1980) to suggest that water depth may be a greater influence than lunar phase.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

The eggs of L. polyphemus develop in sediments 5 to 25 cm below the beach surface. Embryonic development is primarily temperature-related and varies according to the location of nests in the beach (Shuster 1982). The microclimate significant to the development of the eggs is a combination of temperature, moisture, and oxygen (Shuster 1982). Newly laid eggs are sticky and occur as tightly clumped balls, with larvae hatching approximately five weeks later after 4 embryonic molts (Rudloe 1979). Embryos hatch as trilobite larvae and remain in distinct aggregations at depths comparable to those of newly laid eggs (Penn and Brockmann 1994). The larvae may remain in the sand for several weeks, but are capable of feeble swimming, which most often occurs during the night. Buried larvae eventually reach the surface of the sand and emerge into the water column. When larvae first emerge from the nest or when they are first exposed to water, they exhibit a "swimming frenzy" similar to that of neonate sea turtles, swimming vigorously and continuously for hours (Rudloe 1980).Larvae then swim freely for about six days before settlement and molt into the first juvenile instar, which measures approximately 5 mm in prosomal width. This first instar is morphologically similar to all subsequent instars, and generally resembles the adult except for telson length. The behavioral patterns of the animal change abruptly with the molt to the first juvenile instar. At this point in the lifecycle, L. polyphemus ceases the nocturnal swimming characteristic of trilobite larvae (Rudloe 1979) and becomes a benthic animal that alternatively crawls at the surface of the substratum and buries itself in the sand (Rudloe 1981).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Eyes perceive polarized light: horseshoe crab
 

The eyes of horseshoe crabs reduce glare from sunlight because they contain an area that can perceive polarized light.

   
  "The first aquatic species shown to be able to perceive polarized light was the horseshoe crab (Limulus polyphemus), a sea-dwelling chelicerate arthropod whose compound eyes were found by Dr T. H. Waterman in 1950 to contain an area that could analyze light polarization. Since then, Waterman's continuing studies have revealed that many aquatic insects, crustaceans, fishes, and even mollusks such as squid and octopuses exhibit similar abilities that allow them to reduce glare or dazzling reflections caused by bright sunlight, just as we do by wearing polarized sunglasses." (Shuker 2001:49)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limulus polyphemus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBA0004-06|AF216203|Limulus polyphemus| CCGCGATGACTTTATTCAACAAATCACAAAGACATTGGAACAATATATCTAATTTTTGGAATTTGAGCCGCAATAGTAGGGACAGCTCTC---AGAATCTTAATTCGAGCCGAACTTGGCCAACCTGGCTCATTAATTGGAGAT---GATCAAATTTACAACGTAATTGTTACAGCCCACGCATTCGTAATAATTTTTTTTATAGTTATACCTGTAATAATCGGAGGATTTGGAAACTGACTTATTCCTCTAATA---TTAGGGGCCCCTGATATAGCTTTTCCCCGACTCAATAACATAAGCTTTTGACTTCTCCCCCCATCTTTTCTTCTATTACTCAGATCAGCTGCAGTAGAAAGAGGAGCAGGAACAGGTTGAACCGTATACCCTCCTCTAGCATCAGGTATAGCTCACGCAGGAGCCTCAGTAGACTTG---ACAATCTTTTCTCTCCACTTAGCAGGAGTATCATCAATTTTAGGTGCAATTAATTTCATTACCACAATTATTAATATACGAACATCCGGAATAGTACTTGAACGAATACCATTATTCGTTTGATCAGTTAAAATTACTGCAATCCTTCTTCTTCTATCTCTCCCTGTTCTTGCTGGA---GCTATTACAATACTCCTAACAGATCGAAACTTCAATACATCATTTTTTGACCCTGCAGGAGGGGGTGACCCAGTCCTATACCAACATTTATTTTGATTTTTTGGGCACCCTGAAGTCTACATTTTAATTCTTCCTGGGTTTGGAATAATCTCTCATATTATTAGCCACCAAACAGGAAAAAAG---GAACCTTTCGGGACTCTTGGAATAATTTATGCCATATTAGCTATTGGCATTCTTGGTTTTATAGTATGAGCTCACCATATATTTACAGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Limulus polyphemus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Species: 12
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
World Conservation Monitoring Centre

Reviewer/s

Contributor/s

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1986)
  • 1983
    Insufficiently Known
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The horseshoe crab is a "living relic" of the Merostomata, most of which went extinct millions of years ago.

IUCN Red List of Threatened Species: lower risk - near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Lower Risk / Near Threatened (LR/nt) by the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

The population of horseshoe crabs has declined dramatically (4). In the past they were killed in very large numbers by clam diggers, as the species preys on clams. They were also used for animal food (3). In the 1920s and 30s between four and five million individuals were harvested each year (3). At present they are harvested in very large numbers for use as eel and conch bait; in 1996 alone, at least two million horseshoe crabs were killed for this reason (2). Horseshoe crabs have also been used extensively in the biomedical industry for the manufacture of surgical sutures, making dressings for burn victims, and in eye research (2). Furthermore, the copper-based blue blood of this species clots when it comes into contact with toxins released from bacteria. This clotting property, called Limulus Amebocyte Lysate (LAL) is harnessed by pharmaceutical companies needing to test the safety of drugs and other fluids that are to be used on humans (4). In order to make LAL, the companies harvest live horseshoe crabs from breeding beaches and remove a third of their blood before releasing them back into the sea. Studies have shown that 10 to 15 percent of the individuals bled in this way die as a result, accounting for the loss of 20,000 to 37,500 horseshoe crabs each year (2). The world market for LAL is a $50 million per year industry, and this species is essential in its production (2). Other threats facing this ancient species include habitat loss and shoreline development, as well as pollution (2). This unique species is exceptionally vulnerable as it matures very slowly, gathers in large numbers making them 'easy pickings' and by the fact that changes in abundance are not easy to detect. Furthermore, once the population has been reduced it can take as long as ten years for it to recover after harvesting, which roughly corresponds to the length of time it takes for individuals to reach maturity (2). Natural strandings are also a source of considerable mortality (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

It is a sad fact that this ancient living fossil, which has been carrying out its unique life cycle for literally millions of years, is now threatened by human activities. It is clear that the massive level of harvesting of this species must be carefully controlled if the horseshoe crab is to survive, and finding a sustainable level of exploitation is essential (2). It must be carefully managed both as a valuable biological resource, and in its own right, as an amazing remnant of an ancient lineage that pre-dates the dinosaurs. Current actions to conserve this species include tagging and radio-tacking schemes that aim to shed light on the migratory patterns and spawning behaviour of this species. Hopes are that the more we learn about this species, the more likely it is that increasingly effective conservation actions can be devised (2). The Delaware-based Ecological Research and Development Group (ERDG) have been working towards the conservation of the horseshoe crab for a number of years. It places a strong emphasis on educating people about this species and encouraging locals to get involved in conservation action. In 2000 the residents of Broadkill Beach, Delaware designated the three-mile stretch of coast as a horseshoe crab sanctuary, which bans harvesting on the beach. Local people also venture out to return stranded crabs to the water (2). In 2002 the ERDG helped a second Delaware shorefront community, Kitts Hummock, to set up a sanctuary. These are encouraging signs and indicate that decisive conservation action can take place without government intervention (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The study of a horseshoe crab's central nervous system processing functions provided the principles necessary to understand information processes in virtually every other organism investigated.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

A great deal of research has been done on the American horseshoe crab, Limulus polyphemus in the northeast United States, but little is known about the populations on the east coast of Florida. However, a widespread decline in the abundance of L. polyphemus, in the last 20 years may be particularly severe in the Indian River Lagoon (IRL) system, Florida. While the horseshoe crab is not currently listed as threatened, there is a rising concern about the fact that it is absent from turtle nets in the northern IRL, particularly around the Mosquito Lagoon area where it has historically been common. Previous qualitative studies noted large numbers of Limulus weighing down turtle nets on a regular basis in Mosquito Lagoon in 1978-79 (Provancha 1997). However, a 1994 study of loggerhead sea turtles in the IRL revealed that while Limulus were common in the northern Indian River, the number of Limulus caught per survey in Mosquito Lagoon ranged from 0 - 4 animals, with 0 being most common (Provancha 1997).Benefit in the IRL: L. polyphemus and its eggs are an important component of the IRL ecosystem, providing food for threatened loggerhead sea turtles, wading birds, alligators and many species of fish. Its plowing action while feeding supports species diversity, richness and abundance by aerating substrata, thereby affecting infaunal community structure. Because of the horseshoe crab's role in maintaining diversity and productivity in IRL, the alarming decline in numbers over the past twenty years is of serious concern and may serve as an indication of profound environmental disturbance in the lagoon. For example, the noticeable decrease in the number of loggerhead sea turtles being captured during netting surveys is potentially attributable to the decline of L. polyphemus (Provancha 1997), though more research in this area will be needed before definitive causes and effects can be identified. Broad-scale Cost/Benefit: Loss of the horseshoe crab would negatively impact species which feed on the animal and its eggs and decrease biodiversity of the lagoon. The decrease may also indicate serious ecological disturbance in the lagoon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic horseshoe crab

The Atlantic horseshoe crab, Limulus polyphemus, is a marine chelicerate arthropod. Despite its name, it is more closely related to spiders, ticks, and scorpions than to crabs.[2] Horseshoe crabs are most commonly found in the Gulf of Mexico and along the northern Atlantic coast of North America. A main area of annual migration is Delaware Bay, although stray individuals are occasionally found in Europe.[3]

The other three species in the family Limulidae are also called horseshoe crabs.[4] The Japanese horseshoe crab (Tachypleus tridentatus) is found in the Seto Inland Sea, and is considered an endangered species because of loss of habitat. Two other species occur along the east coast of India: Tachypleus gigas and Carcinoscorpius rotundicauda.[5] All four are quite similar in form and behavior.

Contents

Names and classification

This group of animals is also known as horsefoot, or saucepan. Some people call the horseshoe crab a "helmet crab", but this common name is more frequently applied to a true crab, a malacostracan, of the species Telmessus cheiragonus. The term "king crab" is sometimes used for horseshoe crabs, but it is more usually applied to a group of decapod crustaceans.

Limulus means "askew"[6] and polyphemus refers to the giant in Greek mythology.[6] It is based on the misleading idea that the animal had a single eye.

Former scientific names include Limulus cyclops, Xiphosura americana, and Polyphemus occidentalis.

It is the tail that earns this order its name Xiphosura, which derives from the Greek for 'sword tail'.

Despite their common name, they are not crabs but are related to arachnids (spiders, scorpions, ticks and mites).

Anatomy and physiology

Horseshoe crabs have three main parts to the body: the head region, known as the 'prosoma', the abdominal region or 'opisthosoma', and the spine-like tail or 'telson'. The smooth shell or carapace is shaped like a horseshoe, and is greenish grey to dark brown in colour. The sexes are similar in appearance, but females are typically 25 to 30 percent larger than the male and can grow up to 60 centimetres (24 in) in length (including tail).[7]

Horseshoe crabs possess the rare ability to regrow lost limbs, in a manner similar to sea stars.[8]

Underside view. The mouth opening is between the legs, the gills are visible below

A wide range of marine species become attached to the carapace, including algae, flat worms, mollusks, barnacles, and bryozoans, and horseshoe crabs have been described as 'living museums' due to the number of organisms that they can support. In areas where Limulus is common, the shells, exoskeletons or exuviae (molted shells) of horseshoe crabs frequently wash up on beaches, either as whole shells, or as disarticulated pieces.

The brain and the heart are located in the prosoma. On the underside of the prosoma there are six pairs of appendages, the first of which (the small pincers or chelicerae) are used to pass food into the mouth, which is located in the middle of the underside of the cephalothorax, between the chilicerae. Although most arthropods have mandibles, the horseshoe crab is jawless.

Underside of a female showing the legs and book gills.

The second pair of appendages, the pedipalps, are used as walking legs; in males they are tipped with 'claspers' which are used during mating to hold onto the female's carapace. The remaining four pairs of appendages are the 'pusher legs', also used in locomotion. The first four pairs of legs have claws, the last pair has a leaflike structure used for pushing.[9]

Underside of a male, showing the first leg modified for grasping the female during copulation

The opisthosoma bears a further six pairs of appendages; the first pair houses the genital pores, while the remaining five pairs are modified into flattened plates, known as book gills, that allow them to breathe underwater, and can also allow them to breathe on land for short periods of time, provided the gills remain moist.

The telson (i.e., tail or caudal spine) is used to steer in the water and also to flip itself over if stuck upside down.

Among other senses, they have a small chemoreceptor organ which senses smells on the triangular area formed by the exoskeleton beneath the body near the ventral eyes.[10]

Vision

Limulus has been extensively used in research into the physiology of vision. The Nobel prize in Medicine was awarded in 1967 in part for research performed on the horseshoe eye.

There is a large compound eye on each side of the prosoma with monochromatic vision,[note 1][11] five simple eyes on the carapace, and two simple eyes on the underside, just in front of the mouth,[11] making a total of nine eyes. The simple eyes are probably important during the embryonic or larval stages of the organism,[11] and even unhatched embryos seem to be able to sense light levels from within their buried eggs.[12] The less sensitive compound eyes, and the median ocelli, become the dominant sight organs during adulthood.[11]

In addition, the tail bears a series of light-sensing organs along its length.

Each compound eye is composed of about 1000 receptors called ommatidia,[9] complex structures consisting of upwards of 300 cells.[12] The ommatidia are somewhat messily arranged, not falling into the ordered hexagonal pattern seen in more derived arthropods.[11] Each ommatidium feeds into a single nerve fiber. Furthermore, the nerves are large and relatively accessible. This made it possible for electrophysiologists to record the nervous response to light stimulation easily, and to observe visual phenomena like lateral inhibition working at the cellular level. More recently, behavioral experiments have investigated the functions of visual perception in Limulus. Habituation and classical conditioning to light stimuli have been demonstrated, as has the use of brightness and shape information by males when recognizing potential mates.

The retinula (literally, "small retina") cells of the ommatidium of the compound eye contain areas from which membranous organelles of conceivable size (rhabdomeres) extend. Rhabdomeres have tiny microvilli (tiny tubes extending out of the retinula) that interlock with neighboring retinular cells. This forms the rhabdom, which contains the dendrite of the eccentric cell, and may also contribute some microvilli. The only other species with an eccentric cell is the silkworm moth. Microvilli are composed of a double layer, 7 nm each and with 3.5 nm space of two electron-deficient boundaries in between. Where the microvilli meet, these outer borders fuse and yield five membranes about 15 nm thick. In all arthropods, there is always a rhabdom below a crystalline cone, on or near the center of the ommatidium, and always aligned with the path of light. At right angles to the length of the rhabdome are the length of the microvilli, which are in line with each other. The microvilli are about 40-150 nm in diameter.[13]

Blood

The blood of horseshoe crabs (as well as that of most mollusks, including cephalopods and gastropods) contains the copper-containing protein hemocyanin at concentrations of about 50 g per liter.[14] These creatures do not have hemoglobin (iron-containing protein), which is the basis of oxygen transport in vertebrates. Hemocyanin is colorless when deoxygenated and dark blue when oxygenated. The blood in the circulation of these creatures, which generally live in cold environments with low oxygen tensions, is grey-white to pale yellow,[14] and it turns dark blue when exposed to the oxygen in the air, as seen when they bleed.[14] Hemocyanin carries oxygen in extracellular fluid, which is in contrast to the intracellular oxygen transport in vertebrates by hemoglobin in red blood cells.[14]

The blood of horseshoe crabs contains one type of blood cell, the amebocytes. These play an important role in the defense against pathogens. Amebocytes contain granules with a clotting factor known as coagulogen; this is released outside the cell when bacterial endotoxin is encountered. The resulting coagulation is thought to contain bacterial infections in the animal's semiclosed circulatory system.[15]

Life cycle and behavior

Horseshoe crab molting

The crabs feed on mollusks, annelid worms, other benthic invertebrates, and bits of fish. Lacking jaws, it grinds up the food with bristles on its legs and a gizzard that contains sand and gravel.[7]

They spend the winters on the continental shelf and emerge at the shoreline in late spring to spawn, with the males arriving first. The smaller male grabs on to the back of a female with a "boxing glove" like structure on his front claws, often holding on for months at a time. Often several males will hold on to a single female.[16] Females reach the beach at high tide.[16] After the female has laid a batch of eggs in a nest at a depth of 15–20 cm in the sand, the male or males fertilize them with their sperm.[16] Egg quantity is dependent on the female's body size and ranges from 15,000-64,000 eggs per female.[17]

"Development begins when the first egg cover splits and new membrane, secreted by the embryo, forms a transparent spherical capsule" (Sturtevant). The larvae form and then swim for about five to seven days. After swimming they settle, and begin the first molt. This occurs approximately twenty days after the formation of the egg capsule. As young horseshoe crabs grow, they move to deeper waters, where molting continues. Before becoming sexually mature around age 9, they have to shed their shells some 17 times.[7] Longevity is difficult to assess, but the average lifespan is thought to be 20–40 years.[18]

Evolution

Horseshoe crabs were traditionally grouped with the extinct eurypterids (sea scorpions) as the Merostomata. They may have evolved in the shallow seas of the Paleozoic Era (570-248 million years ago) with other primitive arthropods like the trilobites. The four species of horseshoe crab are the only remaining members of the Xiphosura, one of the oldest classes of marine arthropods.

The extinct diminutive horseshoe crab, Lunataspis aurora, 4 centimetres (1.6 in) from head to tail-tip, has been identified in 445-million-year-old Ordovician strata in Manitoba.[19]

Horseshoe crabs are often referred to as living fossils, as they have changed little in the last 445 million years.[7] Forms almost identical to this species were present during the Triassic period 230 million years ago, and similar species were present in the Devonian, 400 million years ago. However, the Atlantic horseshoe crab itself has no fossil record at all, and the genus Limulus "ranges back only some 20 million years, not 200 million."[20]

Medical uses

Horseshoe crabs are valuable as a species to the medical research community, and in medical testing. The above-mentioned clotting reaction of the animal's blood is used in the widely used Limulus Amebocyte Lysate (LAL) test to detect bacterial endotoxins in pharmaceuticals and to test for several bacterial diseases.[6]

Enzymes from horseshoe crab blood are used by astronauts in the International Space Station to test surfaces for unwanted bacteria and fungi.[21]

A protein from horseshoe crab blood is also under investigation as a novel antibiotic.[16]

LAL is obtained from the animals' blood. Horseshoe crabs are returned to the ocean after bleeding, although some 3% die during the process. Studies show that blood volume returns to normal in about a week, though blood cell count can take two to three months to fully rebound.[22]

Conservation and management

The loggerhead sea turtle has suffered from the reduction in numbers of L. polyphemus.

Limulus polyphemus is not presently endangered, but harvesting and habitat destruction have reduced its numbers at some locations and caused some concern for this animal's future. Since the 1970s, the horseshoe crab population has been decreasing in some areas, due to several factors, including the use of the crab as bait in eel, whelk and conch trapping.

Conservationists have also voiced concerns about the declining population of shorebirds, such as red knots, which rely heavily on the horseshoe crabs' eggs for food during their spring migration. Precipitous declines in the population of the red knots have been observed in recent years. Predators of horseshoe crabs, such as the currently threatened Atlantic loggerhead turtle, have also suffered as crab populations diminish.[23]

In 1995, the nonprofit Ecological Research and Development Group [1] (ERDG) was founded with the aim of preserving the four remaining species of horseshoe crab. Since its inception, the ERDG has made significant contributions to horseshoe crab conservation. ERDG founder Glenn Gauvry designed a mesh bag for whelk/conch traps, to prevent other species from removing the bait. This has led to a decrease in the amount of bait needed by approximately 50%. In the state of Virginia, these mesh bags are mandatory in whelk/conch fishery. The Atlantic States Marine Fisheries Commission in 2006 considered several conservation options, among them being a two-year ban on harvesting the animals, affecting both Delaware and New Jersey shores of Delaware Bay.[24] In June 2007, Delaware Superior Court Judge Richard Stokes has allowed limited harvesting of 100,000 males. He ruled that while the crab population was seriously depleted by overharvesting through 1998, it has since stabilized, and that this limited take of males will not adversely affect either horseshoe crab or red knot populations. In opposition, Delaware environmental secretary John Hughes concluded that a decline in the red knot bird population was so significant that extreme measures were needed to ensure a supply of crab eggs when the birds arrived.[25][26] Harvesting of the crabs was banned in New Jersey March 25, 2008.[27]

Every year, about 10% of the horseshoe crab breeding population dies when rough surf flips the creatures onto their backs, a position from which they often cannot right themselves. In response, the ERDG launched a "Just Flip 'Em" campaign, in the hopes that beachgoers will simply turn the crabs back over.

A large-scale project to tag and count horseshoe crabs along the North American coast was underway in the spring and summer of 2008, termed projectlimulus.org.[7] Due to the lack of information and knowledge regarding horseshoe crab populations, the management policies lack any abundance of rules and regulations. To implement management policies for the species, more population information needs to be attained.[28]

See also

Notes

  1. ^ Peak absorption is at 525 nm,

References

  1. ^ World Conservation Monitoring Centre (1996). "Limulus polyphemus". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/11987. Retrieved February 25, 2010. 
  2. ^ Chliboyko, J. Crabby Ancestors, Canadian Geographic Magazine, April 2008, p. 25
  3. ^ "NEAT Chelicerata and Uniramia Checklist" (PDF). http://www.tmbl.gu.se/libdb/taxon/neat_pdf/NEAT*Chelicerata&Uniramia.pdf. Retrieved October 24, 2006. 
  4. ^ "The Horseshoe Crab Natural History: Crab Species". http://www.horseshoecrab.org/nh/species.html. Retrieved 2007-03-01. 
  5. ^ Basudev Tripathy (2006). "In-House Research Seminar: The status of horseshoe crab in east coast of India". Wildlife Institute of India: 5. http://oldwww.wii.gov.in/ars/2006/basudev1.htm. 
  6. ^ a b c Coast by Willie Heard
  7. ^ a b c d e Angier, Natalie (June 10, 2008). "Tallying the Toll on an Elder of the Sea". New York Times. ISSN 0362-4331. http://www.nytimes.com/2008/06/10/science/10angi.html?_r=1&scp=1&sq=crab&st=nyt&oref=slogin. Retrieved June 11, 2008. 
  8. ^ Misty Edgecomb (June 21, 2002). "Horseshoe Crabs Remain Mysteries to Biologists". Bangor Daily News (Maine), repr. National Geographic News. p. 2. http://news.nationalgeographic.com/news/2002/06/0621_020621_wirehorseshoecrab_2.html. 
  9. ^ a b Anatomy of the Horseshoe Crab, Maryland Department of Natural Resources. Retrieved 12 August 2008.
  10. ^ Elizabeth Quinn, Kristen Paradise & Jelle Atema (1998). "Juvenile Limulus polyphemus generate two water currents that contact one proven and one putative chemoreceptor organ". The Biological Bulletin 195 (2): 185–187. JSTOR 1542829. 
  11. ^ a b c d e Battelle, B.A. (December 2006). "The eyes of Limulus polyphemus (Xiphosura, Chelicerata) and their afferent and efferent projections". Arthropod Structure & Development 35 (4): 261–274. doi:10.1016/j.asd.2006.07.002. PMID 18089075. 
  12. ^ a b Harzsch, S.; Hafner, G. (2006). "Evolution of eye development in arthropods: phylogenetic aspects". Arthropod Structure & Development 35 (4): 319–340. doi:10.1016/j.asd.2006.08.009. PMID 18089079. http://linkinghub.elsevier.com/retrieve/pii/S1467803906000570. 
  13. ^ "Photoreception" McGraw-Hill Encyclopedia of Science & Technology, vol. 13, p.461 2007
  14. ^ a b c d Shuster, Carl N (2004). "Chapter 11: A blue blood: the circulatory system". In Shuster, Carl N, Jr; Barlow, Robert B; Brockmann, H. Jane. The American horseshoe crab. Harvard University Press. pp. 276–277. ISBN 0-674-01159-7. http://books.google.com/books?id=0OSAKny-6M4C&printsec=frontcover#PRA1-PA276,M1. 
  15. ^ The history of Limulus and endotoxin, Marine Biological Laboratory. Retrieved 24 September 2008.
  16. ^ a b c d Sandy Huff (April 11, 2004), "Crab Watch", Tampa Tribune 
  17. ^ Leschen, A.S., et al. (2006). "Fecundity and spawning of the Atlantic horseshoe crab, Limulus polyphemus, in Pleasant Bay, Cape Cod, Massachusetts, USA". Marine Ecology 27: 54–65. doi:10.1111/j.1439-0485.2005.00053.x. http://www.blackwell-synergy.com/doi/pdf/10.1111/j.1439-0485.2005.00053.x. 
  18. ^ "Horseshoe crab (Limulus polyphemus)". ARKive. http://www.arkive.org/horseshoe-crab/limulus-polyphemus/info.html. Retrieved March 28, 2010. 
  19. ^ "Ancient horseshoe crabs get even older". Fox News. January 30, 2008. http://www.foxnews.com/story/0,2933,326712,00.html. 
  20. ^ Stephen Jay Gould (1989). Wonderful life: The burgess shale and the nature of history. New York: W.W. Norton & Co.. pp. 43. ISBN 0-393-02705-8. 
  21. ^ "Astronauts Swab the Deck". NASA. http://science.nasa.gov/headlines/y2009/06feb_locad.htm?list208263. Retrieved February 6, 2009. 
  22. ^ "Medical Uses". Ecological Research and Development Group. http://www.horseshoecrab.org/med/med.html. Retrieved FEbruary 21, 2008. 
  23. ^ Juliet Eilperin (June 10, 2005). "Horseshoe Crabs' Decline Further Imperils Shorebirds (subtitle: Mid-Atlantic States Searching for Ways to Reverse Trend)". The Washington Post. p. A03. http://www.washingtonpost.com/wp-dyn/content/article/2005/06/09/AR2005060901894.html. Retrieved May 14, 2006. 
  24. ^ Molly Murray (May 5, 2006). "Seafood dealer wants to harvest horseshoe crabs (subtitle: Regulators look at 2-year ban on both sides of Delaware Bay)". The News Journal. pp. B1, B6. 
  25. ^ "Horseshoe Crabs in Political Pinch Over Bird's Future / Creature is Favored Bait On Shores of Delaware; Red Knot Loses in Court". The Wall Street Journal. June 11, 2007. pp. A1, A10. 
  26. ^ Associated Press. "Judge dumps horseshoe crab protection". Charlotte Observer. 
  27. ^ Associated Press. "NJ to ban horshoe crabbing...". Philly Burbs.Com. http://www.phillyburbs.com/pb-dyn/news/104-03252008-1508360.html. 
  28. ^ "Atlantic States Marine Fisheries Commission: Horseshoe Crab". http://www.asmfc.org/horseshoeCrab.htm. Retrieved June 30, 2009. 

Bibliography

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!