Overview

Brief Summary

Brief Summary

Riftia pachyptila is a giant tube-dwelling annelid in the family Siboglinidae. Siboglinids are important members of deep-sea chemosynthetic communities, which include hydrothermal vents, cold seeps, whale falls, and reduced sediments. As adults, these worms lack a functional digestive system and rely on microbial endosymbionts for their energetic needs. (Hilário et al. 2011)

Riftia pachyptila was discovered on hydrothermal vents at the Galapagos Rift in 1977. It is now known to be a widely distributed inhabitant of vents along the East Pacific Rise and Galápagos Rift (Coykendall et al. 2011). Larvae are estimated to disperse more than 100 km over a 5-week period (Marsh et al. 2001). Studies of vent community succession have shown that R. pachyptila is among the first species to colonize a new vent once suitable conditions are established. Within two years its numbers can grow to several thousand adult individuals, but changes in vent flow or overgrowth by mytilid mussels can lead to its replacement as the dominant species. This process can take months to years, depending on the location. (Coykendall et al. 2011 and references therein)

Coykendall et al. (2011) studied genetic variation among R. pachyptila populations at one mitochondrial and three nuclear loci. They found low rates of genetic variation, especially in southern populations, which exhibit lower occupancy (i.e., percentage of active vents occupied) than do more northern populations. They suggested that the observed geographic pattern of genetic variation is likely explained at least in part by geographic variation in rates of local extinction and (re)colonization. In the Eastern Pacific in general, vent habitats are highly ephemeral, persisting for a few years to several decades before fluid conduits are blocked, magma supplies shift, or lava flows extirpate local communities. On the source side, earthquakes can open fluid conduits, re-activating old vents, and magmatic eruptions spawn new vents.

Hilário et al. (2011) wrote of Riftia pachyptila: “[Riftia pachyptila] became the poster-child of deep-sea discovery, the ‘lost world’ of unknown animal lineages that scientists on the Challenger deep-sea expedition 100 years previously had so wanted, but failed, to find. Arguably, this single species of worm launched the careers of a generation of deep-sea biologists.” At one time, R. pachyptila was placed in its own phylum, the Vestimentifera, although this status was short-lived as a result of new phylogenetic investigations (for review, see Pleijel et al. 2009 and Hilário et al. 2011).

Like other siboglinids, adult R. pachyptila lack a gut, mouth, anus, and conventional feeding ability and possesses bacterial symbionts. (Hilário et al. 2011). Adult R. pachyptila are nourished entirely by sulfur-oxidizing endosymbiotic bacteria (Coykendall et al. 2011). Although the larvae of R. pachytila are symbiont-free and possess a transient digestive system, these digestive structures are lost during development, resulting in adult animals that are nutritionally dependent on their bacterial symbionts. Thus, each generation of tubeworms must be newly colonized with appropriate symbionts. (Nussbaumer et al. 2006)

In the deep sea, aggregations of vestimentiferan tubeworms at hydrothermal vents and hydrocarbon seeps host diverse assemblages of smaller invertebrates. At deep sea hydrothermal vents in the eastern Pacific, R. pachyptila form large and dense aggregations in a spatially and temporally variable environment. The density and diversity of smaller invertebrates is higher in association with aggregations of R. pachyptila than on the surrounding basalt rock seafloor. (Govenar and Fisher 2007 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Forms clusters on rocks in zone of diffuse venting. Feeds only on internal symbiotic sulfide oxidizing bacteria.
  • ARP A.J., CHILDRESS J.J. & R.D. VETTER (1987) J. Exp. Biol. 128: 139-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Riftia pachyptila lives on the ocean floor near hydrothermal vents on the East Pacific Rise, more than a mile under the sea (Cary et al. 1989).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Galapagos Spreading Center, East Pacific Rise (including Guaymas Basin).
  • ARP A.J., CHILDRESS J.J. & R.D. VETTER (1987) J. Exp. Biol. 128: 139-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

An adult R. pachyptila has a tough chitonous tube that grows to over 3 meters tall. At the top of the tube is a large red plume containing hemoglobin that gives R. pachyptila the appearence of a giant paintbrush . Inside the tube, the worm's body is colorless, and holds a large sack called a trophosome (along with its other organs). This sack contains billions of symbiotic bacteria that make food for the worm. The worm has no mouth, eyes, or stomach (Cary et al. 1989; Univ. of Delware Marine Studies 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Four body regions (1) anterior tentacular plume on obturaculum; winged vestimentum; trunk; segmented posterior opisthosome. Plume red, with tentacular lamellae perpendicular to axis; paired halves of apical split end forming operculum upon withdrawal into tube. Vestimentum with dorsolateral flaps overlapping one another ventrally. Opisthosome with variable number of segments, ending in rounded posterior tip. Anterior segments completely encircled with paired single rows of chaetae, becoming incomplete posteriorly. Tube white, smooth, flexible, extremely sturdy, essentially cylindrical, basally blind ending. Tube made of a chitin-protein system.
  • ARP A.J., CHILDRESS J.J. & R.D. VETTER (1987) J. Exp. Biol. 128: 139-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Individual tubes up to 1.5 m.
  • ARP A.J., CHILDRESS J.J. & R.D. VETTER (1987) J. Exp. Biol. 128: 139-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # 984-7
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 984-6
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi l 983
Depth (m): 2457 to 2457
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Foster, Edmond & Corliss
Year Collected: 1977
Locality: Galapagos Rift, Dandelions, Dandelions, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Worm a
Depth (m): 2496 to 2496
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): Donnelly, Corliss & Edmond
Year Collected: 1977
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Worm g
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Foster, Edmond & Corliss
Year Collected: 1977
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Worms b, c, d, e, + four juveniles, e - frozen, thawed in bouins
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Garden Of Eden, Geothermal Vents, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # 884-1 (entire),# 884-2 (entire), # 884-3 (anterior fragment)
Depth (m): 2482 to 2482
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: J-2, sagittal
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Young adults 1-1, 1-2, 1-3, 1-4, 1-5, 1-7, 1-8
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Young adult 1-6
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # 889-2
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # 889-1
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Juveniles
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: J-11, frontal
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: J-3, transverse
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: East Pacific Rise, At 21 N, Baja California, Mexico, North Pacific Ocean
Depth (m): 2595 to 2595
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): Foster, Edmond & Corliss
Year Collected: 1977
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: J-12, frontal
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # 988-2
Depth (m): 2450 to 2450
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-53, childress experiment
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-52, childress experiment
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-17
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-15
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-14
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-13
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-12
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-11
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-10
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 990-9
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 993-3
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 993-2
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Garden Of Eden, Galapagos Islands, Ecuador, North Pacific Ocean
Microhabitat: Whoi # n 993-1
Depth (m): 2485 to 2485
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Riftia pachyptila Jones, 1980
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Woods Hole Oceanographic Institution
Year Collected: 1979
Locality: Galapagos Rift, Rose Garden, Galapagos Islands, Ecuador, North Pacific Ocean
Depth (m): 2451 to 2451
Vessel: Alvin DSR/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

R. pachyptila lives in sulfide rich environments along hydrothermal vents on the ocean floor (Black et al. 1997, Univ. of Delware Marine Studies. 2000).

Aquatic Biomes: benthic ; oceanic vent

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

at hydrothermal vents
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

abyssal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 128 specimens in 1 taxon.
Water temperature and chemistry ranges based on 125 samples.

Environmental ranges
  Depth range (m): 1800 - 3050
  Temperature range (°C): 1.823 - 2.889
  Nitrate (umol/L): 21.028 - 41.112
  Salinity (PPS): 34.663 - 34.944
  Oxygen (ml/l): 2.461 - 5.742
  Phosphate (umol/l): 1.396 - 2.812
  Silicate (umol/l): 34.435 - 161.139

Graphical representation

Depth range (m): 1800 - 3050

Temperature range (°C): 1.823 - 2.889

Nitrate (umol/L): 21.028 - 41.112

Salinity (PPS): 34.663 - 34.944

Oxygen (ml/l): 2.461 - 5.742

Phosphate (umol/l): 1.396 - 2.812

Silicate (umol/l): 34.435 - 161.139
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

R. pachyptila depends on a symbiotic relationship with chemosynthetic bacteria for its food. Although it has no mouth or gut it is born with a mouth through which the bacteria enter. The tube worm uses a feeding sac (called a trophosome) to gather sulfuric chemicals that the bacteria uses to make food for the worm. (Univ. of Delware Marine Studies 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Females release lipid rich eggs which float slowly upward. Males release sperm bundles that contain hundreds of sperm cells. The sperm bundles then swim up to meet the eggs where they are fertilized. The larval worms swim down near the hydrothermal vents and attach to the cooled lava where they grow to form new tube worm communities. (Cary et al. 1989, Univ. of Delware Marine Studies 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 2 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Riftia pachyptila

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBSP0730-06|AY741662|Riftia pachyptila| ATGCGTTGACTATATTCAACTAATCATAAAGACATTGGAACCTTATACTTCTTAGTTGGAATTTGAACAGGTTTAGTAGCCACTAGAATA---AGACTCTTAATTCGAGAGGAACTAGGACAACCAGGAACTCTTTTAGGAGAC---GACCAAATTTACAATTGCTTAATTACAGCCCACGGACTGCTTATGATGTTCTTTGTAGTTCTCCCTATTCTAATGGGAGGCTTCGGAAACTGATTAGTTCCTTTAATG---CTAGGGGCACCTGATATGGCTTTCCCTCGAATTAATAACCTAGGATTCTGATTAATTCCTCCAGCAGTAATTCTTCTAGTAATATCTGCTTTTATTGAAAAAGGAGCTGGAACAGGATGAACTGTGTATCCACCTCTTGCATCTAATATTGCTCATGCCGGTCCATGTATTGATCTA---GCTATTTTTGCTCTTCATCTATCAGGAATTTCATCAATTTTAGCCTCAATTAATTTTATTACAACCGTTATAAATATACGATATAAAGGTCTCCGTCTAGAACGAGTTCCTCTTTTCGTATGAAGAGTTAAATTAACTGCCGTGCTTCTCCTACTTTCAATTCCAGTCCTAGCCGGA---GGATTAACAATACTATTAACTGACCGAAATCTAAACACTTCTTTCTTCGATCCTGCAGGAGGTGGAGACCCAGTCCTATATCAACACTTATTCTGATTTTTTGGCCATCCCGAAGTATATATTTTAGTACTTCCAGGATTTGGATTAATTTCCCATTTAGTTGCACACCATTCAGCTAAATTA---GAACCATTTGGATCTTTAGGAATGATTTATGCTATAATAGGAATTGGACTAATTGGGTTCTTAGTATGAGCTCATCATATGTTTACTATTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Riftia pachyptila

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Giant tube worm

Giant tube worms, Riftia pachyptila, are marine invertebrates in the phylum Annelida[1] (formerly grouped in phylum Pogonophora and Vestimentifera) related to tube worms commonly found in the intertidal and pelagic zones. Riftia pachyptila lives over a mile deep, and up to several miles deep, on the floor of the Pacific Ocean near black smokers, and it can tolerate extremely high hydrogen sulfide levels. These worms can reach a length of 2.4 m (7 ft 10 in).

The common name "giant tube worm" is however also applied to the largest living species of shipworm, Kuphus polythalamia, which despite the name "worm" is a bivalve mollusc, not an annelid.

Contents

Body structure

Hydrothermal vent tubeworms get organic compounds from bacteria that live in their trophosome.

They have a highly vascularized, red "plume" at the tip of their free end which is an organ for exchanging compounds with the environment (e.g., H2S, CO2, O2, etc.). The tube worm does not have many predators, as few creatures live on the sea bottom at such depths. If threatened, the plume may be retracted into the worm's protective tube. The plume provides essential nutrients to bacteria living inside a specialized organ within its body (i.e., trophosome) as part of a symbiotic relationship. They are remarkable in that they have no digestive tract, but the bacteria (which may make up half of a worm's body weight) turn oxygen, hydrogen sulfide, carbon dioxide, etc. into organic molecules on which their host worms feed. This process, known as chemosynthesis, was first recognized by Colleen Cavanaugh while she was a graduate student.[2]

The bright red color of the plume structures results from several extraordinarily complex hemoglobins found in them, which contain up to 144 globin chains (presumably each including associated heme structures). These tube worm hemoglobins are remarkable for carrying oxygen in the presence of sulfide, without being completely "poisoned" or inhibited by this molecule, as hemoglobins in most other species are.[3][4]

Nitrate and nitrite are toxic but nitrogen is required for biosynthetic processes. The chemosynthetic bacteria within the trophosome are able to convert this nitrate to ammonium ions, which then are available for production of amino acids in the bacteria, which are in turn released to the tube worm. In order to transport nitrate to the bacteria, R. pachyptila are able to concentrate nitrate in their blood to a concentration that is 100 times more concentrated than the surrounding water. The exact mechanism of R. pachyptila’s ability to withstand and concentrate nitrate is still unknown.[5]

Energy and nutrient source

With sunlight not available directly as a form of energy, the tubeworms rely on bacteria in their habitat to oxidize hydrogen sulfide,[6] using dissolved oxygen in the water for respiration. They use this reaction for energy in chemosynthesis. For this reason, tube worms are partially dependent on sunlight as an energy source, since they use free oxygen, which has been liberated by photosynthesis in water layers far above, to obtain nutrients. In this way tubeworms are similar to many forms of life which live in the ocean below depths that sunlight can penetrate. However, tubeworms are unique as a large animal, in being able to use bacteria to indirectly obtain all materials they need for growth, from extremely small molecules dissolved in water. Tube worm growth resembles that of hydroponically grown fungi, more than it does that of typical animals which need to "eat".

Reproduction

To reproduce, Riftia pachyptila females release lipid-rich eggs into the surrounding water so they start to float upwards. The males then unleash sperm bundles that swim to meet the eggs. After the eggs have hatched, the larvae swim down to attach themselves to the rock.

Growth rate and age

Riftia pachyptila has the fastest growth rate of any known marine invertebrate. These organisms have been known to colonize a new site, grow to sexual maturity and increase in length to 4.9 feet (1.5 m) in less than two years.[7] This is in sharp contrast to Lamellibrachia luymesi, the tube worms that live at deep sea cold seeps and grow very slowly for most of their lives. It takes from 170 to 250 years for Lamellibrachia luymesi to grow 2 meters in length, and even longer worms have been discovered.[8]

See also

References

Notes
  1. ^ Ruppert, E.; Fox, R.; Barnes, R. (2007). Invertebrate Zoology: A functional Evolutionary Approach (7th ed.). Belmont: Thomson Learning. ISBN 0-03-025982-7. 
  2. ^ Cavanaugh, Colleen M. et al (1981). "Prokaryotic Cells in the Hydrothermal Vent Tube Worm Riftia pachyptila Jones: Possible Chemoautotrophic Symbionts". Science 213 (4505): 340–342. doi:10.1126/science.213.4505.340. PMID 17819907. 
  3. ^ Zal F, Lallier FH, Green BN, Vinogradov SN, Toulmond A (Apr 1996). "The multi-hemoglobin system of the hydrothermal vent tube worm Riftia pachyptila. II. Complete polypeptide chain composition investigated by maximum entropy analysis of mass spectra" (Free full text). J. Biol. Chem. 271 (15): 8875–81. doi:10.1074/jbc.271.15.8875. ISSN 0021-9258. PMID 8621529. http://www.jbc.org/cgi/pmidlookup?view=long&pmid=8621529. 
  4. ^ Minic Z, Hervé G (Aug 2004). "Biochemical and enzymological aspects of the symbiosis between the deep-sea tubeworm Riftia pachyptila and its bacterial endosymbiont" (Free full text). Eur. J. Biochem. 271 (15): 3093–102. doi:10.1111/j.1432-1033.2004.04248.x. ISSN 0014-2956. PMID 15265029. 
  5. ^ Edda Hahlbeck, Mark A. Pospesel, Franck Zal, James Childress, Horst Felbeck (July 2005). "Proposed nitrate binding by hemoglobin in Riftia pachyptila" (Free full text). Deep-Sea Research 52 (10): 1885–1895. doi:10.1016/j.dsr.2004.12.011. ISSN 0967-0637. http://sbr.sb-roscoff.fr/Ecophy/PDF/05-Hahlbeck-DSR.pdf. 
  6. ^ C.Michael Hogan. 2011. Sulfur. Encyclopedia of Earth, eds. A.Jorgensen and C.J.Cleveland, National Council for Science and the environment, Washington DC
  7. ^ Lutz, R. A., et al. "Rapid Growth at Deep-sea Vents." Nature 371 (1994): 663–664.
  8. ^ http://www.sciencedaily.com/releases/2000/02/000203075002.htm
Further reading
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!