Overview

Comprehensive Description

Color: Tube grey/white.
  • MIURA T., TSUKAHARA J. & J. HASHIMOTO (1997) Proc. Biol. Soc. Wash. 110: 447-456.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This tubeworm species lives in shallow water at depths of 82-110 m in Kagoshima Bay and of about 300 m in Nankai Trough. The worms make a cluster on sediment bottom. Most of clusters are less than 5 m in length with about 1 m height, but reaches more than 10 m in length and 3 m in height. Ambient temperature is constant at about 16°C throughout the year. Internal bacteria present, sulfide oxidizers, may chiefly use biogenic hydrogen sulfide rather than volcanic gas.
  • MIURA T., TSUKAHARA J. & J. HASHIMOTO (1997) Proc. Biol. Soc. Wash. 110: 447-456.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

West Pacific: Kagoshima Bay; Nankai Trough.
  • MIURA T., TSUKAHARA J. & J. HASHIMOTO (1997) Proc. Biol. Soc. Wash. 110: 447-456.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Tube rigid, thick walled, tapering to less than 1 mm at posterior end; short external flanges anteriorly, eroded and indistinct in posterior half; sinuous but anterior parts more straight than posterior: Obturaculum cup- or funnel- shape, with smooth interior surface; stalk elliptical in transverse section, with up to 19 pairs of branchial lamellae hidden by up to four pairs of peripheral lamellar sheets. Vestimentum of ale with paired ciliated grooves, diverging at anterior ends. Vestimental cuticular plaques 35-63 mm in diameter, trophosomal ones 51-82 mm.
  • MIURA T., TSUKAHARA J. & J. HASHIMOTO (1997) Proc. Biol. Soc. Wash. 110: 447-456.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Tube length max. 1400 mm; anterior diameter max. 9 mm.
  • MIURA T., TSUKAHARA J. & J. HASHIMOTO (1997) Proc. Biol. Soc. Wash. 110: 447-456.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175101
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175100
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175099
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175098
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175097
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175095
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175094
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175093
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175092
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 122 to 122
Vessel: Natsushima R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175111
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175110
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175109
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175108
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175107
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175106
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175105
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175104
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175103
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Lamellibrachia satsuma Miura
Catalog Number: USNM 175102
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): T. Miura
Year Collected: 1993
Locality: Kyushu Island, Kagoshima Bay, Kagoshima, Japan, North Pacific Ocean
Depth (m): 98 to 98
Vessel: Kaiyo Maru R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 20 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 98 - 122

Graphical representation

Depth range (m): 98 - 122
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lamellibrachia satsuma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTAGTAGGAATCTGAACAGGCTTAGTAGCCACTAGAATAAGACTATTAATTCGAGCTGAACTTGGTCAGCCCGGAACACTCTTAGGAGAT---GATCAAATTTATAATTGCCTTATTACAGCTCATGGACTTCTAATGATATTCTTTGTAGTCCTTCCTATTCTAATAGGAGGATTTGGAAATTGACTAGTTCCTTTAATACTTGGGGCCCCTGATATAGCTTTCCCACGAATCAATAATCTAGGATTTTGACTAATTCCCCCCGCAGTAATCYTACTAGTAATATCTGCTTTTATTGAAAAAGGTGCTGGAACAGGATGAACTGTTTATCCTCCCTTAGCATCCAATATTGCTCATGCAGGACCATGCATTGACCTAGCCATTTTTGCTCTACACCTCTCAGGTGTATCYTCAATTCTAGCCTCAATTAACTTTATTACAACTGTAATAAACATACGATACAAAGGATTACGTCTAGAACGAGTTCCTTTATTTGTATGAAGAGTTAAATTAACCGCAGTACTTCTTCTCCTTTCTATTCCAGTTCTTGCAGGAGGACTTACTATATTACTTACAGATCGAAACTTAAATACATCCTTCTTTGATCCGGCAGGAGGAGGGGATCCAGTTTTATATCAACACTTATTCTGATTCTTTGGTCACCCAGAAGTATACATYTTAGTACTTCCAGGYTTTGGTTTAATTTCTCACCTAGTGGCCCACCATTCTGCTAAACTCGAACCATTCGGTTCACTAGGAATAATTTATGCCATAATAGGAATTGGCTTAATTGGATTTCTAGTATGAGCCCACCATATATTTACTATTGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lamellibrachia satsuma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!