Overview

Comprehensive Description

Color: Grey/white, opaque.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sprawling tangles of tubes lie on muddy surface, with posterior ends burried in sediment or under rocks. Cold seep animals live at ambient sea temperature; Middle Valley animals at fringes of diffuse venting regions with sulphide seepage but no apparent temperature anomaly. Use internal symbiotic sulphide- oxidizing bacteria.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Subduction zone cold seeps on the North America continental margin and a sedimented hydrothermal region at Middle Valley on the Juan de Fuca Ridge.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Tube rigid, thick walled, sinuous, tapering to <1 mm at posterior end; short external flanges anteriorly, eroded and indistinct over much of the tube. Top of obteraculum cupshaped, smooth interior surface, stalk elliptical in section. Obturaculum short (max. 12 mm), about 1/3 length of vestimental region. Branchial filaments are parallel to the obturaculum, forming lamellae of two types: pale outer sheath lamellae (2-5 pairs) made of adherent filaments without pinnules and red inner lamellae of pinnulate filaments.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Tube length max. ca. 1500 mm; anterior diameter 7-12 mm.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Lamellibrachia barhami Webb
Catalog Number: USNM 42837
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): E. Barham
Year Collected: 1966
Locality: Off San Diego, California, North Pacific Ocean
Depth (m): 1125 to 1125
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal to abyssal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1125 - 2521
  Temperature range (°C): 1.744 - 1.824
  Nitrate (umol/L): 40.844 - 41.112
  Salinity (PPS): 34.634 - 34.668
  Oxygen (ml/l): 1.895 - 2.514
  Phosphate (umol/l): 2.812 - 2.984
  Silicate (umol/l): 160.712 - 176.733

Graphical representation

Depth range (m): 1125 - 2521

Temperature range (°C): 1.744 - 1.824

Nitrate (umol/L): 40.844 - 41.112

Salinity (PPS): 34.634 - 34.668

Oxygen (ml/l): 1.895 - 2.514

Phosphate (umol/l): 2.812 - 2.984

Silicate (umol/l): 160.712 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lamellibrachia barhami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAACAGGCCTAGTAGCCACTAGAATAAGACTATTAATTCGAGCTGAACTTGGTCAGCCTGGAACACTCTTAGGAGAC---GACCAAATTTACAATTGCCTTATTACAGCTCATGGGCTTCTAATAATATTCTTTGTAGTTCTCCCTATTCTAATAGGAGGATTTGGAAATTGACTAGTTCCTTTAATACTTGGGGCCCCTGATATAGCTTTCCCACGAATCAATAATCTAGGATTTTGACTAATCCCCCCCGCAGTAATCTTACTAGTAATATCTGCTTTTATTGAAAAAGGTGCCGGAACAGGATGAACTGTTTATCCTCCCTTAGCATCCAATATCGCTCATGCAGGACCATGCATTGACTTAGCCATTTTTGCTCTACACCTTTCAGGTGTATCCTCAATTTTGGCCTCAATTAATTTTATTACAACTGTAATAAACATACGATATAAAGGATTACGTCTAGAACGAGTTCCTTTATTTGTATGAAGAGTTAAATTAACCGCAGTTCTTCTTCTTCTTTCAATTCCAGTTCTTGCAGGAGGACTTACCATATTACTTACAGACCGAAACTTAAATACATCCTTCTTTGACCCGGCGGGGGGAGGGGACCCAGTTCTATATCAACATTTATTCTGGTTCTTTGGCCACCCAGAATTATACATCTTAATACTTCCAGGCTTTGGTTTAATTTCTCACCTAGTAGCTCACCATTCTGCTAAACTTGAACCATTCGGATCACTAGGAATAATTTATGCCATAATAGGAATTGGACTAATTGGATTCCTAGTATGAGCCCACCATATATTTACCATTGGAATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lamellibrachia barhami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lamellibrachia barhami

Lamellibrachia barhami is a large pogonophore.[1]

Description[edit]

Its tentacular crown is formed of several, fused, horseshoe-shaped tentacle lamellae. The second segment has two body folds, near which open the genital ducts. The trunk, which comprises 89 per cent of the total body length, is undifferentiated. The true metasoma, is without setae. The heart is a simple muscular elaboration of the anterior end of the ventral blood vessel. The brain is large, and from it arises a pair of intra-epidermal nerve cords which extend the full length of the vestimental region; thereafter they join and form the a nerve cord of the trunk. Associated with the brain and the nerve cords are the dorsal tubes.[1]

References[edit]

  1. ^ a b Webb, Michael. "Lamellibrachia barhami, gen. nov., sp. nov.,(Pogonophora), from the Northeast Pacific." Bulletin of Marine Science 19.1 (1969): 18-47.

Further reading[edit]

  • Kiel, Steffen, ed. The Vent and Seep Biota: Aspects from Microbes to Ecosystems. Vol. 33. Springer, 2010.
  • MacLeod, C. J., Paul A. Tyler, and C. L. Walker, eds. "Tectonic, magmatic, hydrothermal and biological segmentation of mid-ocean ridges." Geological Society of London, 1996.
  • Beesley, Pamela L., Graham JB Ross, and Christopher J. Glasby, eds.Polychaetes & allies: the southern synthesis. Vol. 4. CSIRO publishing, 2000.
  • Van Dover, Cindy. The ecology of deep-sea hydrothermal vents. Princeton University Press, 2000.
  • Sigvaldadóttir, Elín, Andrew SY Mackie, and Gudmundur V. Helgason, eds.Advances in Polychaete Research. Vol. 170. Springer, 2003.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!