Overview

Comprehensive Description

Color: Grey/white, opaque.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sprawling tangles of tubes lie on muddy surface, with posterior ends burried in sediment or under rocks. Cold seep animals live at ambient sea temperature; Middle Valley animals at fringes of diffuse venting regions with sulphide seepage but no apparent temperature anomaly. Use internal symbiotic sulphide- oxidizing bacteria.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Subduction zone cold seeps on the North America continental margin and a sedimented hydrothermal region at Middle Valley on the Juan de Fuca Ridge.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Tube rigid, thick walled, sinuous, tapering to <1 mm at posterior end; short external flanges anteriorly, eroded and indistinct over much of the tube. Top of obteraculum cupshaped, smooth interior surface, stalk elliptical in section. Obturaculum short (max. 12 mm), about 1/3 length of vestimental region. Branchial filaments are parallel to the obturaculum, forming lamellae of two types: pale outer sheath lamellae (2-5 pairs) made of adherent filaments without pinnules and red inner lamellae of pinnulate filaments.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Tube length max. ca. 1500 mm; anterior diameter 7-12 mm.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Lamellibrachia barhami Webb
Catalog Number: USNM 42837
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): E. Barham
Year Collected: 1966
Locality: Off San Diego, California, North Pacific Ocean
Depth (m): 1125 to 1125
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

bathyal to abyssal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1125 - 2521
  Temperature range (°C): 1.744 - 1.824
  Nitrate (umol/L): 40.844 - 41.112
  Salinity (PPS): 34.634 - 34.668
  Oxygen (ml/l): 1.895 - 2.514
  Phosphate (umol/l): 2.812 - 2.984
  Silicate (umol/l): 160.712 - 176.733

Graphical representation

Depth range (m): 1125 - 2521

Temperature range (°C): 1.744 - 1.824

Nitrate (umol/L): 40.844 - 41.112

Salinity (PPS): 34.634 - 34.668

Oxygen (ml/l): 1.895 - 2.514

Phosphate (umol/l): 2.812 - 2.984

Silicate (umol/l): 160.712 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lamellibrachia barhami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAACAGGCCTAGTAGCCACTAGAATAAGACTATTAATTCGAGCTGAACTTGGTCAGCCTGGAACACTCTTAGGAGAC---GACCAAATTTACAATTGCCTTATTACAGCTCATGGGCTTCTAATAATATTCTTTGTAGTTCTCCCTATTCTAATAGGAGGATTTGGAAATTGACTAGTTCCTTTAATACTTGGGGCCCCTGATATAGCTTTCCCACGAATCAATAATCTAGGATTTTGACTAATCCCCCCCGCAGTAATCTTACTAGTAATATCTGCTTTTATTGAAAAAGGTGCCGGAACAGGATGAACTGTTTATCCTCCCTTAGCATCCAATATCGCTCATGCAGGACCATGCATTGACTTAGCCATTTTTGCTCTACACCTTTCAGGTGTATCCTCAATTTTGGCCTCAATTAATTTTATTACAACTGTAATAAACATACGATATAAAGGATTACGTCTAGAACGAGTTCCTTTATTTGTATGAAGAGTTAAATTAACCGCAGTTCTTCTTCTTCTTTCAATTCCAGTTCTTGCAGGAGGACTTACCATATTACTTACAGACCGAAACTTAAATACATCCTTCTTTGACCCGGCGGGGGGAGGGGACCCAGTTCTATATCAACATTTATTCTGGTTCTTTGGCCACCCAGAATTATACATCTTAATACTTCCAGGCTTTGGTTTAATTTCTCACCTAGTAGCTCACCATTCTGCTAAACTTGAACCATTCGGATCACTAGGAATAATTTATGCCATAATAGGAATTGGACTAATTGGATTCCTAGTATGAGCCCACCATATATTTACCATTGGAATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lamellibrachia barhami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!