Lamellibrachia barhami — Details

learn more about names for this taxon

Overview

Comprehensive Description

Learn more about this article

Color: Grey/white, opaque.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Biologiezentrum Linz/Austria

Source: Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Sprawling tangles of tubes lie on muddy surface, with posterior ends burried in sediment or under rocks. Cold seep animals live at ambient sea temperature; Middle Valley animals at fringes of diffuse venting regions with sulphide seepage but no apparent temperature anomaly. Use internal symbiotic sulphide- oxidizing bacteria.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Biologiezentrum Linz/Austria

Source: Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

East North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Subduction zone cold seeps on the North America continental margin and a sedimented hydrothermal region at Middle Valley on the Juan de Fuca Ridge.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Biologiezentrum Linz/Austria

Source: Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Tube rigid, thick walled, sinuous, tapering to <1 mm at posterior end; short external flanges anteriorly, eroded and indistinct over much of the tube. Top of obteraculum cupshaped, smooth interior surface, stalk elliptical in section. Obturaculum short (max. 12 mm), about 1/3 length of vestimental region. Branchial filaments are parallel to the obturaculum, forming lamellae of two types: pale outer sheath lamellae (2-5 pairs) made of adherent filaments without pinnules and red inner lamellae of pinnulate filaments.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Biologiezentrum Linz/Austria

Source: Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Tube length max. ca. 1500 mm; anterior diameter 7-12 mm.
  • JONES M.L. (1985) Bull. Biol. Soc. Wash. 6:117-158.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Biologiezentrum Linz/Austria

Source: Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Paratype for Lamellibrachia barhami Webb
Catalog Number: USNM 42837
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Collector(s): E. Barham
Year Collected: 1966
Locality: Off San Diego, California, North Pacific Ocean
Depth (m): 1125 to 1125
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Learn more about this article

bathyal to abyssal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 1125 - 2521
  Temperature range (°C): 1.744 - 1.824
  Nitrate (umol/L): 40.844 - 41.112
  Salinity (PPS): 34.634 - 34.668
  Oxygen (ml/l): 1.895 - 2.514
  Phosphate (umol/l): 2.812 - 2.984
  Silicate (umol/l): 160.712 - 176.733

Graphical representation

Depth range (m): 1125 - 2521

Temperature range (°C): 1.744 - 1.824

Nitrate (umol/L): 40.844 - 41.112

Salinity (PPS): 34.634 - 34.668

Oxygen (ml/l): 1.895 - 2.514

Phosphate (umol/l): 2.812 - 2.984

Silicate (umol/l): 160.712 - 176.733
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

 

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lamellibrachia barhami

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGAACAGGCCTAGTAGCCACTAGAATAAGACTATTAATTCGAGCTGAACTTGGTCAGCCTGGAACACTCTTAGGAGAC---GACCAAATTTACAATTGCCTTATTACAGCTCATGGGCTTCTAATAATATTCTTTGTAGTTCTCCCTATTCTAATAGGAGGATTTGGAAATTGACTAGTTCCTTTAATACTTGGGGCCCCTGATATAGCTTTCCCACGAATCAATAATCTAGGATTTTGACTAATCCCCCCCGCAGTAATCTTACTAGTAATATCTGCTTTTATTGAAAAAGGTGCCGGAACAGGATGAACTGTTTATCCTCCCTTAGCATCCAATATCGCTCATGCAGGACCATGCATTGACTTAGCCATTTTTGCTCTACACCTTTCAGGTGTATCCTCAATTTTGGCCTCAATTAATTTTATTACAACTGTAATAAACATACGATATAAAGGATTACGTCTAGAACGAGTTCCTTTATTTGTATGAAGAGTTAAATTAACCGCAGTTCTTCTTCTTCTTTCAATTCCAGTTCTTGCAGGAGGACTTACCATATTACTTACAGACCGAAACTTAAATACATCCTTCTTTGACCCGGCGGGGGGAGGGGACCCAGTTCTATATCAACATTTATTCTGGTTCTTTGGCCACCCAGAATTATACATCTTAATACTTCCAGGCTTTGGTTTAATTTCTCACCTAGTAGCTCACCATTCTGCTAAACTTGAACCATTCGGATCACTAGGAATAATTTATGCCATAATAGGAATTGGACTAATTGGATTCCTAGTATGAGCCCACCATATATTTACCATTGGAATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Lamellibrachia barhami

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!