Overview

Brief Summary

Biology

in whalebones
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

The body of the female emerges from the whale bone in a gelatinuous hemispherical tube that is 7 mm in diameter. The crown is composed of four palps and a cylindrical oviduct. The contracted crown plumes measure 0.95 cm in length. The oviduct is filled with ellipsoid eggs with a mean diameter of 146 by 117 um. The oviduct is convoluted upon contraction, and extends between the palps, 3 mm from the trunk. The palps are red with two longitudinal white stripes in living specimens. Pinnules are present on the inner margins of the palps. The trunk is 4.5 mm long and 0.9 mm wide, and is marked by a white coloured thickened tissue at the anterior. A green, bacterio-cyte filled sheath forms at the junction of the trunk and oviduct, measuring 1.2 mm long by 1mm wide. The ovisac is lobulate, with dimensions of 6.5 mm by 5 mm by 3 mm. The ovisac and roots are inflated with clear fluid in situ in the bone, which is lost on extraction.

Paedomorphic males are found clustered around the oviduct in the female tubes, and measure 0.15 - 0.25 mm long. The males have an anterior prototroch and posterior hooked chaete. The chaete have hooks and handles 15 - 21 um. The hooks lack a rostrum and are comprised of capitium with curved teeth over a subrostral process. The capitium have five teeth, but lack subrostral teeth.

(Rouse et al., 2004)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Types found on grey whale bones from 2891 m depth in Monterey Bay, California (36°36.8`N, 122°26.0`W) (Rouse et al., 2004).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1922 - 2891

Graphical representation

Depth range (m): 1922 - 2891
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Nucleotide sequence analysis for mitochondrial COI, mitochondrial 16S rRNA and nuclear 18S rRNA confirmed that Osedax frankpressi and O. rubiplumus are distinct species (Rouse et al., 2004).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology

Barcode data: Osedax frankpressi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTACTGCTCACGGCCTCTTAATAATATTTTTCGTTGTAATACCTATTTTAATAGGAGGATTTGGTAATTGGCTAGTTCCTCTGATA---CTCGGTGCTCCAGATATAGCATTCCCTCGAGTAAATAACCTTGCATTCTGACTCCTTCCCCCAGCCGTTATTCTTCTAGTTATATCAGCTTTTATTGGTAAAGGTGCAGGGCCAGGATGAACCGTATACCCTCCTTTAGCCTCTAATCTAGCACATGCAGGACCATCTATTGATTTA---GCCATTTTTTCACTACATCTTTCTGGTGTTTCCTCAATTTTAGGATCAATTAACTTCATTACTACTATAATAAACATACGATACGACGGCCTACGGTTAGAACGTGTACCATTATATGTATGAAGAGTTAAACTAACAGCTGTTCTCCTTCTTCTATCAATTCCAATTCTAGCTGGA---GGTATTACTATACTTCTTACAGACCGAAATCTAAACACTTCATTCTTTGACCCAGCAGGAGGTGGTGACCCAGTCCTATTCCAACATCTATTTTGATTCTTTGGACATCCTGAAGTATATATTTTAGTATTACCAGGGTTTGGGATTATTTCCCATATAGTAGCTCATTACTCAGCTAAACTT---GAGCCATTTGGAACTTTAGGTATAATCTACGCTATAATAGGAATTGGCCTAATTGGCTTCCTTGTATGAGCCCACCACATATTTACTATTGGGATAGACGTTGATACTCGAGCTTACTTCACTGCAGCAACTATAATTATTGCAGTACCAACAGGTATTAAAGTATTTAGATGACTA---GCCACAATCCACGGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Osedax frankpressi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Osedax frankpressi

Osedax frankpressi is a species of bathypelagic Polychaetes that is reported to sustain itself on the bones of dead whales. It can be found in East North Pacific.[2]

References

  1. ^ G. W. Rouse, S. K. Goffredi, and R. C. Vrijenhoek (2004). "Osedax: Bone-Eating Marine Worms with Dwarf Males". Science (Washington DC) 305: 668–671. doi:10.1126/science.1098650. PMID 15286372. 
  2. ^ Fauchald, K. (2004). "Osedax frankpressi Rouse, Goffredi & Vrijenhoek, 2004". World Register of Marine Species. Retrieved March 20, 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!