Overview

Distribution

southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), downstream part of the St. Lawrence estuary, lower St. Lawrence estuary; Cobscook Bay
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-arctic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

colour is generally brownish with a distinct metallic iridescence
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

white for recently molted
  • Trott, Thomas
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal to deep sea
  • Neuhaus, B.; van der Land, J. (2001). Cephalorhyncha (=Loricifera, Priapulida, Kinorhyncha, Nematomorpha), in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 159-160
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 114 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 0 - 1380
  Temperature range (°C): -1.363 - 11.461
  Nitrate (umol/L): 1.175 - 23.955
  Salinity (PPS): 10.036 - 35.617
  Oxygen (ml/l): 0.438 - 8.441
  Phosphate (umol/l): 0.093 - 3.061
  Silicate (umol/l): 3.812 - 70.311

Graphical representation

Depth range (m): 0 - 1380

Temperature range (°C): -1.363 - 11.461

Nitrate (umol/L): 1.175 - 23.955

Salinity (PPS): 10.036 - 35.617

Oxygen (ml/l): 0.438 - 8.441

Phosphate (umol/l): 0.093 - 3.061

Silicate (umol/l): 3.812 - 70.311
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

feeds on other marine worms
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Priapulus caudatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCGCGATGATTTTTTTCAACTAATCATAAGGACATTGGAACAATATATTTAATTTTTGGATTTTGATCTGCCATAGTTGGTTCAGGGTTAAGTTTAATTATTCGAGCTGAACTCGGGCAAGCAGGCTCCCTTCTAGGAGAC---GATCACCTATATAATGTGATTGTTACTGCCCACGCATTTGTAATGATTTTTTTTATAGTAATGCCTATTTTAATTGGGGGTTTTGGTAACTGAATGCTTCCATTAATATTAGGAGCACCAGACATAGCCTTTCCACGATTAAACAATTTAAGTTTCTGATTATTACCACCCTCATTAACGCTTCTTTTAGCCTCTTCTTTAGTAGAAGCAGGTGCCGGGACTGGTTGGACTGTTTACCCCCCTCTAGCTAGAAATATTGCTCACGCCGGTGGCTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTGCTTCTTCCATTTTAGGGGCAGTAAATTTTATTACAACAGTGATTAATATACGTACTGAGGGGATAGTTTTTGAGCGAATCCCGCTTTTTGTTTGAGCAGTCAAAATCACAGTTGTTTTACTTCTTCTTTCACTCCCAGTCCTTGCTGGGGCAATCACTATATTATTGACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGGAGGAGACCCTATTCTGTACCAACATCTTTTTTGATTTTTTGGTCACCCTGAAGTATATATTCTTATTTTACCAGGCTTTGGAATTGTCTCACATATTATCAACCATCAAAGAGGAAAAAAGGAAGCATTCGGTAACCTCGGTATAATTTATGCTATACTGGCTATTGGGGTTTTAGGATTTGTTGTATGGGCACACCATATATTCACAGTAGGTATAGACGTTGACACGCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Priapulus caudatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!