Molecular Biology and Genetics

Molecular Biology

Barcode data: Thaumetopoea pityocampa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AGTAGGCACATCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGTGATGACCAAATCTATAACACAATTGTCACAGCCCATGCTTTTATTATAATTTTTTTCATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAATCCCTCTAATATTAGGAGCACCAGATATAGCATTCCCCCGTATAAATAATATAAGCTTCTGACTCTTACCTCCATCCTTAACTTTATTGATCTCAAGTAGAATTGTAGAAAATGGAGCTGGCACTGGATGAACTGTTTACCCCCCCCTATCTTCAAATATTGCCCACAGAGGTAACTCTGTTGATCTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATGCGACTTAATAATATATCTTTTGATCAAATACCCCTATTTGTTTGAGCTGTGGGAATTACAGCTTTTCTCCTTCTACTATCATTACCCGTTTTAGCGGGAGCTATTACTATATTGTTAACAGATCGTAACTTAAATACATCTTTTTTTGATCCGGCAGGAGGAGGAGACCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thaumetopoea pityocampa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pine Processionary

The Pine Processionary (Thaumetopoea pityocampa) is a moth of the family Thaumetopoeidae. It is sometimes placed in the genus Traumatocampa, is one of the most destructive species to pines and cedars in Central Asia, North Africa and the countries of southern Europe.[1] The urticating hairs of the caterpillar larvae cause harmful reactions in humans and other mammals. The species is notable for the behaviour of its caterpillars, which overwinter in tent-like nests high in pine trees, and which process through the woods in nose-to-tail columns, protected by their severely irritating hairs,[2] as described by the pioneering entomologist Jean Henri Fabre.

Egg[edit]

The typical cylindrical egg masses range in length from 4 to 5 cm. They are covered with the scales of the female anal tuft, which mimics the pine shoots.[3]

Adult[edit]

Adult

The Pine Processionary adult has cream coloured forewings with brown markings, and white hindwings. The female moth has a wing-span of 36 – 49 mm while the male is 31 – 39 mm.[3] The species flies from May to July.

Pupa[edit]

Pupation takes place in the soil in an oval, ocheous-white silken cocoon. The obtect pupae are about 20 mm in length, oval, and of a pale brownish-yellow colour that later changes to dark reddish-brown.[3]

Larva[edit]

The larva is a major forest pest, living communally in large "tents", usually in pine trees but occasionally in cedar or larch, marching out at night in single file (hence the common name) to feed on the needles. There are often several such tents in a single tree. When they are ready to pupate, the larvae march in their usual fashion to the ground, where they disperse to pupate singly on or just below the surface.

The larvae should never be handled as the abundant hairs on their bodies cause extreme irritation (urticaria) to the skin.[4] 5th stage larvae can eject hairs when threatened or stressed; the hairs, which have the form of harpoons, then penetrate and irritate all areas of exposed skin nearby with an urticating protein.[5] Allergic reactions may follow in susceptible individuals on subsequent exposure to the hairs.[6]

Fabre conducted a famous study on the processionary pine larvae where a group of them were attached nose-to-tail in a circle with food just outside the circle; they continued marching in the circle for a week.[7] The caterpillars may follow a trail of pheromones or silk, but the main stimuli that induce following are from the hairs (setae) on the end of the abdomen of the caterpillar in front.[6] The ant mill is a similar phenomenon.[8]

Life cycle[edit]

The life cycle of the pine processionary is normally annual but may extend over 2 years at high altitude or in northern latitudes for part or the whole of the population. The life cycle has two phases, the adult, egg and caterpillar being aerial and the pupa hypogeal.Moths lay their eggs high on pine trees. After hatching, the larvae go through five instars, eating pine needles. They build white silken nests to maintain ideal living conditions. Around the end of March the caterpillars are ready to leave their nests and move down the tree in a characteristic procession. They dig underground and pupate, emerging at the end of the summer.[3] High numbers of adults are produced in years with a warm spring.[9]

Shelter building[edit]

'Tent' made by larvae in pine tree; frass collects at the bottom of the tent.

The caterpillars are highly social. At first they are nomadic, spinning and abandoning a series of flimsy shelters constructed by enveloping a few needles in silk but in the third instar they initiate the construction of a permanent nest or "tent" and settle down to become central place foragers. There are no definitive openings in the shelter that allow the caterpillars to enter and exit. Rather, the caterpillars force their way through the layers of the shelter as they move in and out. The frass that is produced as the caterpillars process their meals accumulates at the bottom of the tent.[6]

Midwinter foraging and thermoregulation[edit]

Colonies are active throughout the winter months. Activity records of colonies foraging in pine forests in mountainous regions near Barcelona, Catalonia, obtained with infrared activity monitors, show that the caterpillars leave their nests soon after sunset and travel to distant feeding sites located on the branches of the host tree. Here they feed overnight then return to the nest at dawn. Observations in mid-winter show that the caterpillars forage on the coldest of nights and are able to locomote, albeit very slowly, at sub-zero temperatures. The permanent nests are typically sited to intercept solar radiation and during sunny days warm to well above ambient temperatures. The caterpillars rest in the nest during the day and at the elevated body temperatures they experience due to heating of the nest by the sun are able to efficiently digest the food they collect overnight. By March the caterpillars are in the fifth instar and are fully grown. At this time the leave their nest, following each other in long head to tail processions and seek out pupation sites in the soil.[6]

Trail marking and processionary behaviour[edit]

The caterpillars lay down a pheromone trail from the tip of the abdomen as they advance over the branches of the host tree. Although the caterpillars also secrete silk and mark their pathways with the material, it plays little or no role in trail following. Most likely, silk helps the caterpillars grip on smooth plant surfaces. The caterpillars can distinguish old from new trails. Caterpillars preferentially follow trails marked by larger numbers of caterpillars. Trail marking enables the caterpillars to aggregate at feeding sites and allows them to find their way back to nest after feeding. When they move over the branches, caterpillars may travel head to tail in small groups or alone. In either case, they rely on the trail marker to find their way.[6]

The most spectacular processions are formed when the caterpillars are fully grown and abandon the host tree in search of pupation sites, when as many as three hundred caterpillars may travel long distances from the natal tree looking for soft soil in which to bury themselves and form cocoons. During processions, stimuli from setae on the tip of the abdomen of the caterpillar in front serve to hold processions together, taking priority over the trail pheromone or silk. A caterpillar can readily be induced to follow a model made of a wooden dowel covered with the integument of the abdomen of a killed caterpillar.[6]

Anti-predator defence[edit]

The caterpillars of the pine processionary are highly urticating in the third and subsequent instars. Contact with the hairs causes skin rashes and eye irritations. Susceptible individuals may also develop an allergic response to a protein associated with the hairs of the caterpillar.[6]

Natural controls[edit]

The Pine Processionary is an economic pest in coniferous forests in southern Europe. It is controlled to some extent by predators, parasites and viruses which attack the moth at different stages of its life-cycle:[5]

Artificial control[edit]

Efforts to control the pine processionary have included biological control using Bacillus thuringiensis, which can be effective on eggs and first or second stage caterpillars (in September or October),[10] or insecticides such as diflubenzuron, an insect growth regulator, which can be sprayed from aircraft.[11] Monitoring can include the use of pheromone traps.[10] Older methods used insecticides in oil, inserted directly into nests, or mechanical removal of nests.[10]

Bibliography[edit]

  • Arnaldo P, C. S., Lopes D. (2010). Effects of defoliation by the pine processionary moth, Thaumetopoea pityocampa on biomass growth of young stands of Pinus pinaster in Northern Portugal. iForest, [online: November 15]. Retrieved June 21, 2013, from http://dx.doi.org/doi: 10.3832/ifor0553-003.
  • Brindley, H. H. 1910. Further notes on the procession of Cnethocampa pinivora. Proc. Cambridge Phil. Soc. 15:576–587.
  • Bryner, R. (2000): Thaumetopoea pityocampa. — In: Pro Natura – Schweizerischer Bund für Naturschutz (Hrsg.) (2000): Schmetterlinge und ihre Lebensräume. Arten, Gefährdung, Schutz. Schweiz und angrenzende Gebiete. Band 3: 521-524. Egg (Fotorotar AG).
  • Chinery, Michael. Collins Guide to the Insects of Britain and Western Europe. Collins, 1986. (Reprinted 1991)
  • Dajoz, R. 2000. Insects and Forests. The Role and Diversity of Insects in the Forest Environment. Lavoisier publishing, Paris.
  • Demolin, G. 1962. Comportement des chenilles de Thaumetopoea pityocampa au cours des processions de nymphose. C. R. Acad. Sci. 254:733–744.
  • Demolin, G. 1971. Incidences de quelques facteurs agissant sur le comportment social des chenilles de Thaumetopoea pityocampa Schiff. (Lepidoptera) pendant la période des processions de nymphose. Répercussion sur l’efficacité des parasites. Ann. Zool. –Ecol. anim., no hors série: 33–56.
  • Ducombs, G., Lamy, M., Mollard, S., Guillard, J. M., and Maleville, J. 1981. Contact dermatitis from processional pine caterpillar (Thaumetopoea pityocampa Schiff., Lepidoptera). Contact Dermatitis 7:287–288.
  • Edwards, T. G. 1910. On the procession and pupation of the larva of Cnethocampa pinivora. Proceedings of the Cambridge Philosophical Society 15:431-436.
  • Fabre, J-H. 1898. Souvenirs Entomologiques. 6:298–392.
  • Fabre, J-H. 1916. The Life of the Caterpillar. Dodd, Mead. New York.
  • Fitzgerald, T. D. 2003. The role of a trail pheromone in the foraging and processionary behavior of Thaumetopoea pityocampa. J. Chem. Ecol. 29(3):513–532.
  • Fitzgerald, T. D. 2008. Lethal Fuzz. Natural History Magazine 117:28–33 (September).
  • Halperin. J. 1990. Life history of Thaumetopoea spp. (Lep., Thaumetopoeidae) in Israel. J. Appl. Ent. 110:1–6.
  • Lamy, M., Pastureaud, M-H., Novak, F., Ducombs, G., Vincendeau, P., Maleville, J., and Texier, L. 1986. Thaumetopoein: an urticating protein from the hairs an integument of the pine procession caterpillar (Thaumetopoea pityocampa Schi ff., Lepidoptera,Thaumetopoeidae). Toxicon 24:347–356.
  • Mallmann, R. J. 1962. Observations sur les réactions tactiles de la chenille processionnaire du pin, Thaumetopoea pityocampa Schiff. Insectes sociaux 9:335-345.
  • Réaumur, M. 1736. Mémoires pour l'histoire des Insectes, II. Paris.
  • Vega, J. M., Mo neo, I., Armentia, A., Fernández, J., Vega, J., De La Fuente, R., Sanchez, P., and Sánchís, E. 1999. Allergy to the pine processionary caterpillar (Thaumetopoea pityocampa). Clinical and Experimental Allergy 29:1418-1423.

References[edit]

  1. ^ Biomed figure
  2. ^ FMV
  3. ^ a b c d Pest profile: pine processionary moth
  4. ^ "Fabre, J-H. ''The Life of the Caterpillar''. Chapter VI. The Pine Processionary: The Stinging Power". Efabre.net. Retrieved 2013-05-08. 
  5. ^ a b c d e f g h Bonnet, Catherine and Jean-Claude Martin and René Mazet (August–October 2008). "La Processionnaire du Pin". Stantari No. 14. INRA. pp. 29–33. Retrieved 29 December 2011. 
  6. ^ a b c d e f g Terrence Fitzgerald. "Pine Processionary Caterpillar". Web.cortland.edu. Retrieved 2013-05-08. 
  7. ^ Fabre, J-H. The Life of the Caterpillar. Chapter III: The Procession.
  8. ^ Delsuc F. (2003). "Army Ants Trapped by Their Evolutionary History". PLoS Biology 1 (2): e37. doi:10.1371/journal.pbio.0000037. PMC 261877. PMID 14624241. 
  9. ^ Mestre, João. Forest Health and Climate Changes. Universidade de Trás-os-Montes is Alto Douro, 2012.
  10. ^ a b c Control of the pine processionary
  11. ^ Treatment with growth regulators
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!