Molecular Biology and Genetics

Molecular Biology

Barcode data: Eublemma parva

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGTACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGGTCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCATTAATACTTGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTCTACCCCCTTCTTTAACTCTTCTAATTTCGAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTAAATAACTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCCTTCTTATTATTACTTTCATTACCAGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTCGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eublemma parva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eublemma parva

The Small Marbled (Eublemma parva) is a species of moth of the Noctuidae family. It is found from North Africa and southern Europe to Central Asia. Also Middle East, Turkey, Caucasus, Transcaucasia, Iraq, Iran, Afghanistan, Pakistan, Northwest India It is a migratory species and is also found north of the Alps.

Technical Description and variation[edit]

See glossary for terms used

The wingspan is 14–18 millimetres (0.55–0.71 in).[2] Forewing pale ochreous, tinged with yellowish; the median shade preceded by brown suffusion, inwardly diffuse, outwardly concise, sinuous, projecting on each fold and edged with white ; outer line brown, somewhat quadrately projecting between 6 and 4, edged with pale, and followed by a brown cloud running into apex: a black dot on discocellular ; submarginal line pale, hardly marked, containing a black speck below apex ; hindwing brownish grey, whiter towards base; — the ab. rubefacta Mab, from Corsica and Sicily, shows the basal and terminal areas of forewing dark brown tinged With rosy; the brown median shade and its pale edging very prominent; the hindwing dark; — in typical specimens the space between median and outer lines remains pale ochreous or brownish; in several examples, especially females, from Morocco, Spain, and Syria this space is finely dusted with pearl grey, = ab. griseata ab. nov.[Warren].[3]

Habitat.Profitis Ilias, Rhodes, Greece

Biology[edit]

Adults are on wing from March to November.

The larvae feed on Inula, Centaurea, Helichrysum and Gnaphalium species. Larvae can be found from July to September.

References[edit]

  1. ^ Eublemma at funet
  2. ^ "Small Marbled Eublemma parva". UK Moths. Retrieved June 14, 2011. 
  3. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!