Molecular Biology and Genetics

Molecular Biology

Barcode data: Eublemma parva

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCCGGAATAGTAGGTACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGGTCATTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCATTAATACTTGGAGCCCCAGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTCTACCCCCTTCTTTAACTCTTCTAATTTCGAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATGGAGGAAGATCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTAAATAACTTATCTTTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCCTTCTTATTATTACTTTCATTACCAGTTTTAGCTGGAGCCATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTCGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eublemma parva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eublemma parva

The Small Marbled (Eublemma parva) is a species of moth of the Noctuidae family. It is found from North Africa and southern Europe to central Asia. It is a migratory species and is also found north of the Alps.

The wingspan is 14–18 millimetres (0.55–0.71 in).[2] Adults are on wing from March to November.

The larvae feed on Inula, Centaurea, Helichrysum and Gnaphalium species. Larvae can be found from July to September.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!