Overview

Brief Summary

The silkworm is the larva or caterpillar of the domesticated silkmoth, Bombyx mori. This species is an economically important insect, having been domesticated in China from the wild ancestor Bombyx mandarina in about 2700 BC for sericulture (silk production). In comparison to the wild form, B. mori has a larger cocoon, faster rate of growth, increased fecundity and disease resistance. Additionally, the adults have lost the ability to fly and lack fear of potential predators. These changes have made it entirely dependent upon humans for survival and it no longer occurs naturally in the wild.

Bombyx mori's preferred food is white mulberry leaves, but it may also eat the leaves of any other mulberry tree (e.g., Morus rubra or Morus nigra) as well as the Osage Orange. Silkworm larvae grow to about 4 cm long, and then build a cocoon in which to pupate. This cocoon is collected and boiled to harvest the 300-900 meter long single silk thread from which it is made. Sometimes the boiled pupae are then eaten (called ground cucumber). Like most adults in the family Bombycidae, B. mori moths have reduced mouth parts so do not feed. Male and female moths are similarly colored, but where males have a wingspan of 3–5 cm, females have vestigial wings and much larger bodies, holding hundreds of eggs.

Bombyx mori has been used as a model organism in biological and genetic studies, and its full genome (~432 Mb) was sequenced and published in 2008.

(Wikipedia, 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Bombyx mori originally existed in the wild throughout Asia. Though they are believed to no longer exist in the wild, they are in the care of the silk industry in Asia and Australia (Savela 1998).

Biogeographic Regions: oriental (Native ); australian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The larvae of B. mori are caterpillars that are about 4 cm long, including their horned tail. They are buff-colored with brown thoracic markings. The adults are moths with a 4 cm wingspan. They are also buff-colored, but have thin brown lines on their whole bodies (Herbison-Evans 1997). Another silkworm, Bombyx mandarina, appears to be a wild race of B. mori (Savela 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Although B. mori is native to China, it does not live in the wild any longer because of sericulture (Encarta 1998).

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bombyx mori are herbivores. They feed specifically on white mulberry leaves, but also eat Osage oranges and lettuce. They do most of their eating in the larval stage (Encarta 1998). The larvae have mandibles for feeding, while the adults have sucking mouth parts (Lepidoptera Part 2 1997). Because they have been cultivated for so long for sericulture (the silk industry), B. mori have lost an adaptation helpful to feeding in the wild. The larvae can no longer hang on plants at gravity-defying angles, and must be fed by humans (Herbison-Evans 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Bombyx mori are holometabolous and reproduce sexually. The female adult dies upon depositing her eggs (Encarta 1998). These eggs weigh in at a miniscule 1/30,000 of an ounce each (Knowledge Adventure 1997). After 10 days, the eggs hatch and hungry larvae emerge. They are segmented and have body hair. The larvae eat and grow for approximately 6 weeks, and then they begin the next stage of their lives. Bombyx mori produce a fluid in their silk glands that is forces through spinnerets on their mouths. This fluid hardens in the air to produce the silk thread that they will wrap around themselves to form their cocoons. Bombyx mori spend 2 weeks as pupae in the safety of their cocoons before emerging as adults (Encarta 1998). Inside the cocoon, much of their bodies die by an attack of their own digestive juices. This process, histolysis, clears away the old parts to make way for the new ones that will develop in this pupal state. After this process is completed, the adults break free from the cocoon in order to begin the cycle again. The adults are winged and have traded body hair for scales. They are dramatically different form their larval stage (Lepidoptera Part 2 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Oily coating serves dual purpose: silk moth
 

The antennae of male silk moths distribute chemicals by having an oily coating that serves a dual purpose by binding to lipid-loving female pheromones and transporting them to nerve cells.

     
  "[A] coating on the male silk moth's antenna...helps  it smell nearby female moths. The coating catches pheromone molecules  in the air and carries them through nanotunnels in the exoskeleton to  nerve cells that send a message to the bug's brain. 'These  pheromones are lipophilic. They like to bind to lipids, or fat-like  materials. So they get trapped and concentrated on the surface of this  lipid layer in the silk moth. The layer greases the movement of the  pheromones to the place where they need to be,' [according to Michael  Mayer, an associate professor in the University of Michigan's  departments of Biomedical Engineering and Chemical Engineering]" (Moore  2011:1)
  Learn more about this functional adaptation.
  • Yusko EC; Johnson JM; Majd S; Prangkio P; Rollings RC; Jiali L; Yang J; Mayer M. 2011. Controlling protein translocation through nanopores with bio-inspired fluid walls. Nature Nanotechnology. 6(4): 253-260.
  • Moore NC. 2011. Silk moth's antenna inspires new nanotech tool with applications in Alzheimer's research. EurekAlert [Internet], Accessed 28-Feb-2011.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Shearing forces increase molecular alignment: silkworms
 

The silk-spinning organ of silkworms enhances crystallization and coagulation of the liquid silk product via shearing forces that help align the molecules.

   
  "RAMSDEN (1938) observed that shearing of the viscous contents of silk glands between glass slides would cause it to coagulate. IIZUKA (1966) studied the effect of shear rate on the coagulation of fibroin solutions and also analyzed the dimensions of the spinneret of the silk worm Bombyx mori with regard to the shearing forces arising in this tube. He concluded that the shearing forces in the spinneret align molecules thus enhancing crystallization and also align the randomly oriented crystals thus promoting coagulation. The greater the shearing forces, the higher the degree of crystallinity of the product." (Wainwright 1976:77)
  Learn more about this functional adaptation.
  • Wainwright, S. A. 1982. Mechanical Design in Organisms. Princeton University Press.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bombyx mori

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 61 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GTENK035-11|PRJNA13125|Bombyx mori| CGAAAATGAATTTATTCTACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGTATTTGATCAGGAATAATTGGAACATCTTTA---AGACTTTTAATTCGAGCTGAATTAGGAAATCCAGGATCATTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATA---CTAGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTCCTACCCCCCTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATCGCACATAGAGGAAGATCCGTAGATCTT---GCTATTTTTTCACTACATTTAGCAGGTATTTCATCAATTATAGGAGCAATTAATTTTATTACAACAATAATTAATATACGATTAAATAATATATCATTTGATCAATTACCCTTATTTGTATGAGCTGTAGGGATTACAGCATTTTTATTATTATTATCACTACCTGTTTTAGCTGGA---GCTATTACAATATTATTAACAGATCGAAACTTAAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTTTACCAGGATTTGGTATAATTTCTCATATTATTTCACAAGAAAGAGGAAAAAAA---GAAACTTTTGGTTGTTTAGGAATAATTTATGCTATACTAGCAATTGGGTTATTAGGATTCATTGTTTGAGCTCATCATATATTCACTGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bombyx mori

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 51
Species: 62
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Bombyx mori is currently not an endangered or threatened species; however, many animal rights activist groups object to their use in sericulture. One of the main things the activists are offended by is the silk industry's practice of boiling cocoons with living pupae inside in order to get the silk (envirolink 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

In 1989, 74 thousand tons of silk were produced (Lepidoptera Part 2 1997). Even with each cocoon yeilding one half mile of fibers, that is an astounding amount of silk (The Animal World 1990). Bombyx mori is an incredibly important species to humans because we rely on their silk for our textile and clothing industries. For many years, China had a monopoly on the benifits of this industrious animal. In fact, Bombyx mori are one of the few animals that carried the death penalty as a punishment for smuggling them out of their native country (Lepidoptera Part 2 1997).

Bombyx mori are quite important animals in the science world as well. They are used in Australia for educational purposes in schools (Herbison-Evans 1997). Scientists in the field of sericulture are working on mapping their genes in hopes of improving the quality of the world's silk and expanding our knowledge of genetics in general. Bombyx mori were the animals in which pheromones were first discovered and named (Pines 1997).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bombyx mori

The silkworm is the larva or caterpillar of the domesticated silkmoth, Bombyx mori (Latin: "silkworm of the mulberry tree"). It is an economically important insect, being a primary producer of silk. A silkworm's preferred food is white mulberry leaves, but it may also eat the leaves of any other mulberry tree (i.e., Morus rubra or Morus nigra)[citation needed] as well as the Osage Orange. It is entirely dependent on humans for its reproduction and does not occur naturally in the wild. Sericulture, the practice of breeding silkworms for the production of raw silk, has been underway for at least 5,000 years in China,[1] from where it spread to Korea and Japan, and later to India and the West. The silkworm was domesticated from the wild silkmoth Bombyx mandarina which has a range from northern India to northern China, Korea, Japan and far the eastern regions of Russia. The domesticated silkworm derives from Chinese rather than Japanese or Korean stock.[2][3] It is unlikely that silkworms were domestically bred before the Neolithic age: it was not until then that the tools required to facilitate the manufacturing of larger quantities of silk thread had been developed. The domesticated B. mori and the wild B. mandarina can still breed and sometimes produce hybrids.[4]:342

Contents

Types

Mulberry silkworms can be categorized into 3 different, but connected groups or types. The major groups of silkworms fall under the univoltine and bivoltine categories. The Univoltine breed is generally linked with the geographical area within greater Europe. The eggs of this type hibernate during winter due to the cold climate, and cross fertilise only by spring, generating silk only once annually. The second type of breed is called Bivoltine and is normally found in Asian regions such as Japan, China and Korea. The breeding process of this type takes place twice annually, a feat made possible through the slightly warmer climates and the resulting two lifecycles. The Polyvoltine breed of mulberry silkworm can only be located in the tropics. The eggs are laid by female moths and hatch within nine to twelve days, so the resulting type can have up to 8 separate lifecycles throughout the year.[5]

Process

Eggs take about fourteen days to hatch into larvae, which eat continuously. They have a preference for white mulberry, having an attraction to the mulberry odorant cis-jasmone. They are not monophagous since they can eat other species of Morus as well as some other Moraceae. Their droppings are black. Hatchlings and second-instar larvae are called kego and chawki in India. They are covered with tiny black hairs. When the color of their heads turns darker, it indicates that they are about to molt. After molting, the instar phase of the silkworm emerges white, naked, and with little horns on the backs.

After they have molted four times (i.e., in the fifth instar phase), their bodies become slightly yellow and the skin becomes tighter. The larvae will then enter the pupa phase of their life cycle and enclose themselves in a cocoon made up of raw silk produced by the salivary glands. The cocoon provides a vital layer of protection during the vulnerable, almost motionless pupal state. Many other Lepidoptera produce cocoons, but only a few—the Bombycidae, in particular the Bombyx genus, and the Saturniidae, in particular the Antheraea genus—have been exploited for fabric production.

If the animal is allowed to survive after spinning its cocoon and through the pupa phase of its life cycle, it will release proteolytic enzymes to make a hole in the cocoon so that it can emerge as a moth. These enzymes are destructive to the silk and can cause the silk fibers to break down from over a mile in length to segments of random length, which ruins the silk threads. To prevent this, silkworm cocoons are boiled. The heat kills the silkworms and the water makes the cocoons easier to unravel. Often, the silkworm itself is eaten (see Cuisine). The moth – the adult phase of the life cycle – cannot fly. Silkmoths have a wingspan of 3–5 cm (1.5–2 inches) and a white hairy body. Females are about two to three times bulkier than males (for they are carrying many eggs), but are similarly colored. Adult Bombycidaes have reduced mouth parts and do not feed, though a human caretaker can also[clarification needed] feed them.

Cocoon

Cocoon

The cocoon is made of a thread of raw silk from 300 to about 900 meters (1,000 to 3,000 feet) long. The fibers are very fine and lustrous, about 10 micrometers (1/2,500th of an inch) in diameter. About 2,000 to 3,000 cocoons are required to make a pound of silk. At least 70 million pounds of raw silk are produced each year, requiring nearly 10 billion pounds of mulberry leaves. The FAO estimates the world production of raw silk at 164971 tonnes in 2009[6] . According to E. L. Palmer, one pound of silk represents about 1,000 miles of filament. The annual world production represents 70 billion miles of silk filament. This silk is usually processed to remove natural waxes or gums such as the sericin, a water-soluble protective layer that solidifies immediately when exposed to air. It is sometimes subsequently dyed.

[7]

Research

Due to its miniature size and ease of culture, the silkworm has become a model organism in the study of Lepidopteran and arthropod biology. Fundamental findings on pheromones, hormones, brain structures and physiology have been made with the silkworm.[citation needed] One example of this was the molecular identification of the first known pheromone, bombykol which required extracts from 500,000 individuals, due to the very small quantities of pheromone produced by any individual worm.[citation needed]

Currently, research is focusing on genetics of silkworms and the possibility of genetic engineering. Many hundreds of strains are maintained, and over 400 Mendelian mutations have been described.[citation needed] Another source suggests 1000 inbred domesticated strains are kept worldwide.[8] One useful development for the silk industry are silkworms that can feed on food other than mulberry leaves, including an artificial diet.[citation needed] Research on the genome also raises the possibility of genetically engineering silkworms to produce proteins, including pharmacological drugs, in the place of silk proteins.

Kraig Biocraft Laboratories[9] has used research from the Universities of Wyoming and Notre Dame in a collaborative effort to create a silkworm that is genetically altered to produce spider silk. In September 2010 it was announced at a press conference at the University of Notre Dame that the effort had been successful.[10]

In January 2010, National University of Singapore together with Republic Polytechnic were in the process of creating "super" silk.[11] The "super" silk are produced by coaxing "silkworms to spin stronger silk by exposing them (silkworms) to an electric field before they (silkworms) spin" .[12] Silk produced through this new method is so strong as to be bullet-proof.

Researchers at Tufts developed scaffolds made of spongy silk that feel and look similar to human tissue. They are implanted during reconstructive surgery to support or restructure damaged ligaments, tendons, and other tissue. They also created implants made of silk and drug compounds which can be implanted under the skin for steady and gradual time release of medications. [13]

Domestication

The domesticated variety, compared to the wild form, has increased cocoon size, growth rate and efficiency of its digestion. It has also gained tolerance to human presence and handling and living in crowded conditions. It also cannot fly and lacks fear of potential predators. These changes have made it entirely dependent upon humans for survival.[14]

Silkworm breeding

Pupa

The silkworm is one of the world's most genetically modified animals. Silkworms were first domesticated in China over 5000 years ago.[15][16] Since then, the silk production capacity of the species has increased nearly tenfold. Silkworm is one of the few organisms wherein the principles of genetics and breeding were applied to harvest maximum output. It is next only to maize in exploiting the principles of 'heterosis' and 'cross breeding'. Silkworm breeding is aimed at the overall improvement of silkworm from a commercial point of view. The major objectives of silkworm breeding are improving fecundity, healthiness of larvae, quantity of cocoon and silk production, disease resistance, etc. Fecundity refers to the egg laying capacity of a breed. It is a very important factor, since commercial sericulture is strongly dependent on silkworm egg availability. Healthiness of larvae leads to a healthy cocoon crop. Healthiness is dependent on factors such as better pupation rate, fewer dead larvae in the mountage, shorter larval duration (the shorter the larval duration, the lesser the chances of infection) and bluish tinged fifth instar larvae (it is observed that bluish colored fifth instar larvae are healthier than the reddish brown ones). Quantity of cocoon and silk produced is directly related to the pupation rate and larval weight. Healthier larvae have greater pupation rates and cocoon weights. Quality of cocoon and silk depends on a number of factors including genetics. Specific purposes apart from commercial purpose are given attention by advanced countries to breed development for specific purposes like sericin production, sex limited breeds, thin/thick filament production etc. Disease resistance breeding is important, as the major reason for crop losses is pathogen infection. Efforts are being made to select breeds which are tolerant or resistant to various pathogens. [1]

Silkworm raising as hobby and school science project

In the USA, teachers may sometimes introduce insect life cycle to their students by raising silkworms in the classroom as a science project. Students have a chance to observe complete life cycles of insect from egg stage to larvae, pupa, moth and eggs.

The silkworm has been raised as a hobby in China and South Africa. Children often pass on the eggs, creating a noncommercial population. The experience provides children with the opportunity to witness the lifecycle of silkworms. The practice of raising silkworms by children as pets has, in the non-silkfarming country of South Africa, led to the development of extremely hardy landraces of silkworm. This is because they are invariably subjected to hardships not encountered by commercially-farmed members of the species.[17] However, these worms, not being selectively bred as such, are possibly inferior in silk production and may exhibit other undesirable traits.

Genome

The full genome of the silkworm was published in 2008 by the International Silkworm Genome Consortium.[8]

The genome of the silkworm is mid-range with a genome size of ~432 Mb. It was published in 2008 by the International Silkworm Genome Consortium.[8] A draft sequence was published in 2004.[18]

High genetic variability has been found in domestic lines of silkworms, though this is less than that among wild silkmoths (~83%). This suggests a single event of domestication, and that it happened over a short period of time, with a large number of wild worms having been collected for domestication.[19] Major questions, however, remain unanswered: “Whether this event was in a single location or in a short period of time in several locations cannot be deciphered from the data,” Research also has yet to identify the area in China where domestication arose.[20]

Cuisine

Silkworm pupae dishes

Like many insect species, silkworm pupae are eaten in some cultures (see Entomophagy). This unusual food may go by the English phrase "ground cucumber."

  • In Korea, they are boiled and seasoned to make a popular snack food known as beondegi.
  • In China, street vendors sell roasted silkworm pupae.
  • In Vietnam, this is known as con nhộng.
  • Silkworms have also been proposed for cultivation by astronauts as space food on long-term missions.[21]

Silkworm legends

In China, there is a legend that the discovery of the silkworm's silk was by an ancient empress Lei Zu, the wife of the Yellow Emperor and the daughter of XiLing-Shi. She was drinking tea under a tree when a silk cocoon fell into her tea. As she picked it out and started to wrap the silk thread around her finger, she slowly felt a warm sensation. When the silk ran out, she saw a small larva. In an instant, she realized that this caterpillar larva was the source of the silk. She taught this to the people and it became widespread. There are many more legends about the silkworm.

The Chinese guarded their knowledge of silk, but, according to one story, a Chinese princess given in marriage to a Khotan prince brought to the oasis the secret of silk-manufacture, "hiding silkworms in her hair as part of her dowry", probably in the first half of the 1st century CE.[22] It is also said that about AD 550, Christian monks smuggled silkworms, in a hollow stick, out of China and sold the secret to the Byzantine Empire.

Silkworm diseases

Nosema bombycis is a microsporidium that kills 100% of silkworms hatched from infected eggs. This disease can be carried over from worms to moths, then eggs and worms again. This microsporidium comes from the food that silkworms eat. If silkworms get this microsporidium in their worm stage, there are no visible symptoms. However, mother moths will pass the disease onto the eggs, and 100% of worms hatching from the diseased eggs will die in their worm stage. To prevent this disease, it is therefore extremely important to rule out all eggs from infected moths by checking the moth’s body fluid under a microscope.

Botrytis bassiana is a fungus that destroys the entire silkworm body. This fungus usually appears when silkworms are raised under cold conditions with high humidity. This disease is not passed on to the eggs from moths, as the infected silkworms cannot survive to the moth stage. This fungus can spread to other insects.

Grasserie: If grasserie is observed in chawkie stage, then the chawkie larvae must have been infected while hatching or during chawkie rearing. Infected eggs can be disinfected by cleaning their surface prior to hatching. Infections can occur as a result of improper hygiene in the chawkie rearing house. This disease develops faster in early instar rearing.

Pebrine is a disease caused by a parasitic microsporidian, Nosema bombycis Nageli. Diseased larvae show slow growth, an undersized, pale and flaccid body, and poor appetite. Tiny black spots appear on larval integument. Additionally, dead larvae will remain rubbery and do not undergo putrefaction after death.

Traditional Chinese medicine

Silkworm is the source of the "stiff silkworm", which is made from dried 4th or 5th instar larvae which have died of white muscardine disease (a lethal fungal infection). Its uses are to dispel flatulence, dissolve phlegm and relieve spasms.

See also

References

Footnotes

  1. ^ E. J. W. Barber (1992). Prehistoric Textiles: the Development of Cloth in the Neolithic and Bronze Ages with Special Reference to the Aegean. Princeton University Press. p. 31. ISBN 978-0-691-00224-8. http://books.google.com/books?id=HnSlynSfeEIC&lpg=PA31&dq=yangshao%20dynasty%20silkworm%20discovery&pg=PA31. 
  2. ^ K. P. Arunkumar, Muralidhar Metta & J. Nagaraju (2006). "Molecular phylogeny of silkmoths reveals the origin of domesticated silkmoth, Bombyx mori from Chinese Bombyx mandarina and paternal inheritance of Antheraea proylei mitochondrial DNA". Molecular Phylogenetics and Evolution 40 (2): 419–427. doi:10.1016/j.ympev.2006.02.023. PMID 16644243. 
  3. ^ Hideaki Maekawa, Naoko Takada, Kenichi Mikitani, Teru Ogura, Naoko Miyajima, Haruhiko Fujiwara, Masahiko Kobayashi & Osamu Ninaki (1988). "Nucleolus organizers in the wild silkworm Bombyx mandarina and the domesticated silkworm B. mori". Chromosoma 96 (4): 263–269. doi:10.1007/BF00286912. http://www.springerlink.com/content/x37p1p3363178q36/fulltext.pdf. 
  4. ^ Brian K. Hall (2010). Evolution: Principles and Processes. Topics in Biology. Jones & Bartlett Learning. p. 400. ISBN 978-0-7637-6039-7. http://books.google.com/books?id=V24EHUgEl5EC&lpg=PA342. 
  5. ^ Trevisan, Adrian. "Cocoon Silk: A Natural Silk Architecture". Sense of Nature. http://www.senature.com/research/publications/cocoon-silk-a-natural-architecture. 
  6. ^ "faostat.fao.org". http://faostat.fao.org/site/603/DesktopDefault.aspx?PageID=603#ancor. 
  7. ^ "faostat.fao.org". http://faostat.fao.org/site/603/DesktopDefault.aspx?PageID=603#ancor. 
  8. ^ a b c The International Silkworm Genome Consortium (2008). "The genome of a lepidopteran model insect, the silkworm Bombyx mori". Insect Biochemistry and Molecular Biology 38 (12): 1036–1045. doi:10.1016/j.ibmb.2008.11.004. PMID 19121390. 
  9. ^ "Kraig Biocraft Laboratories". http://www.kraiglabs.com/. 
  10. ^ "University of Notre Dame". http://science.nd.edu/research/profiles/fraser_silkworms.htm. 
  11. ^ "NUS: Creating "Super" Silk". R2m.nus.edu.sg. http://r2m.nus.edu.sg/cos/o.x?c=/r2m/pagetree&func=view&rid=5434. Retrieved 18 October 2011. 
  12. ^ "The Straits Times: Silk So Strong You Can Turn it into Bullet-proof vest" (PDF). http://www.nus.edu.sg/enterprise/enterprisezone-newsletter/public_mediacoverage/2010/Jan10/20100123%20-%20ST%20Pg%20D8%201%20_23%20Jan%202010_.pdf. Retrieved 18 October 2011. 
  13. ^ "Wolchover,Natalie". http://seedmagazine.com/content/article/the_silk_renaissance/. 
  14. ^ Marian R. Goldsmith, Toru Shimada & Hiroaki Abe (2005). "The genetics and genomics of the silkworm, Bombyx mori". Annual Review of Entomology 50: 71–100. doi:10.1146/annurev.ento.50.071803.130456. PMID 15355234. 
  15. ^ Hong-Song Yu1, Yi-Hong Shen, Gang-Xiang Yuan, Yong-Gang Hu1, Hong-En Xu1, Zhong-Huai Xiang and Ze Zhang. "Evidence of selection at melanin synthesis pathway loci during silkworm domestication". Molecular Biology and Evolution 28 (6): 1785-99 year=2011. doi:10.1093/molbev/msr002. PMID 21212153. 
  16. ^ Dennis Normile (2009). "Sequencing 40 Silkworm Genomes Unravels History of Cultivation". Science 325: 1058-1059. doi:10.1126/science.325_1058a. PMID 19713499. 
  17. ^ "Silkworm School Science Project Instruction" (PDF). http://www.silkwormeggs.net/resources/Silkworm-School-Science-Project-Instruction.pdf. Retrieved 18 October 2011. 
  18. ^ Kazuei Mita, Masahiro Kasahara, Shin Sasaki, Yukinobu Nagayasu, Tomoyuki Yamada, Hiroyuki Kanamori, Nobukazu Namiki, Masanari Kitagawa, Hidetoshi Yamashita, Yuji Yasukochi, Keiko Kadono-Okuda, Kimiko Yamamoto, Masahiro Ajimura, Gopalapillai Ravikumar, Michihiko Shimomura, Yoshiaki Nagamura, Tadasu Shin-i, Hiroaki Abe, Toru Shimada, Shinichi Morishita & Takuji Sasaki (2004). "The genome sequence of silkworm, Bombyx mori". DNA Research 11 (1): 27–35. doi:10.1093/dnares/11.1.27. PMID 15141943. 
  19. ^ Qingyou Xia, Yiran Guo, Ze Zhang, Dong Li, Zhaoling Xuan, Zhuo Li, Fangyin Dai, Yingrui Li, Daojun Cheng, Ruiqiang Li, Tingcai Cheng, Tao Jiang, Celine Becquet, Xun Xu, Chun Liu, Xingfu Zha, Wei Fan, Ying Lin, Yihong Shen, Lan Jiang, Jeffrey Jensen, Ines Hellmann, Si Tang, Ping Zhao, Hanfu Xu, Chang Yu, Guojie Zhang, Jun Li, Jianjun Cao, Shiping Liu, Ningjia He, Yan Zhou, Hui Liu, Jing Zhao, Chen Ye, Zhouhe Du, Guoqing Pan, Aichun Zhao, Haojing Shao, Wei Zeng, Ping Wu, Chunfeng Li, Minhui Pan, Jingjing Li, Xuyang Yin, Dawei Li, Juan Wang, Huisong Zheng, Wen Wang, Xiuqing Zhang, Songgang Li, Huanming Yang, Cheng Lu, Rasmus Nielsen, Zeyang Zhou, Jian Wang, Zhonghuai Xiang & Jun Wang (2009). "Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx)" (PDF). Science 326 (5951): 433–436. Bibcode 2009Sci...326..433X. doi:10.1126/science.1176620. PMID 19713493. http://life.cqu.edu.cn/zezhang/silkwormDomest_Sci09-10-16.pdf. 
  20. ^ Dennis Normile (2009). "Sequencing 40 silkworm genomes unravels history of cultivation". Science 325 (5944): 1058–1059. Bibcode 2009Sci...325.1058N. doi:10.1126/science.325_1058a. PMID 19713499. 
  21. ^ Choi, Charles Q. (13 January 2009). "Care for a Silkworm With Your Tang?". ScienceNOW Daily News. http://news.sciencemag.org/sciencenow/2009/01/13-02.html. Retrieved 14 January 2009. 
  22. ^ Sarah Underhill Wisseman, Wendell S. Williams. Ancient Technologies and Archaeological Materials . Routledge, 1994. ISBN 2-88124-632-X. Page 131.

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Bombyx Hybrid

The Bombyx hybrid is a hybrid between a Bombyx mori female and a male Bombyx mandarina moth. They produce Silkworm larvae like all species of Bombyx. The larvae look a lot like the other variation, they are brown and the first half and gray at the bottom half, but they get larger black spots than the other variation, and they look like a normal Bombyx moth, but a bit darker. Instead, no hybrids are used for silk, (unlike a normal Silkworm of the Bombyx mori species), but for research. Bombyx mori females are much more likely to mate with a male Bombyx mandarina, but both species have to be kept in the same container. Since Bombyx Hybrids are much more common than the other variation more is known about them.

The domesticated silkworm (B. mori) was domesticated from wild silkworm (B. mandarina) more than 5,000 years ago.[1]

See Also

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!