Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Mostly Appalachians and coastal plain currently from the New Jersey Pine Barrens and south- central Pennsylvania through most of Florida and west into southern Ohio then south through eastern Kentucky etc. to the Gulf states then as far west as southeastern Louisiana. Formerly also widely from northern Pennsylvania well into Maine to Oxford and Brunswick at least. It is unclear if this species actually is widespread through the southern piedmont or not.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: While it becomes increasingly associated with pitch pine, but apparently not really pine barrens per se, northward, from southern New Jersey and central Pennsylvania southward this is a widespread species in coastal plain pine woods an in the mountains where pines are common in more mixed forests.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Varies regionally and not necessarily as expected based on latitude. Extinct northeastern populations had moths basically in early-mid July. Apparently mostly June now in Pennsylvania. In southern New Jersey and probably the Delmarva region there is a bimodal first brood with an early peak in very late May to mid June depending on the spring and another peak about 3-4 weeks after the first, and some years a partial second brood in early August. In Ohio and the southern Appalachians adults are much later, i.e. mostly in July. In the coastal Carolinas two broods starting about the end of April but the second supposedly not until early August (suggesting a short diapause or much slower development than in New Jersey). Records from March to October in Florida could possibly be two broods as suggested by Tuskes et al (1996) but more likely represent three or four broods. In New Jersey and DELMARVA egg stage takes 9-12 days and the larval stage about 4-6 weeks and non-diapausing pupae hatch in 3-4 weeks. Pupae overwinter and rarely do so twice (at least in New Jersey).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Citheronia sepulcralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTCGGAATTTGAGCCGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCTGAATTAGGTACTCCAAGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTCACAGCCCATGCCTTTATTATAATTTTTTTCATAGTTATACCCATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTCCCCCCCTCACTAACTCTTTTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCCTCTAATATTGCTCACGGAGGATCTTCAGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGGGCAATTAATTTTATTACTACAATCATTAATATGCGACTAAATAATATATCATTTGATCAAATACCATTATTCGTTTGAGCTGTAGGGATTACAGCATTTCTCTTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTTTTAACTGATCGTAATTTAAACACTTCTTTCTTTGACCCAGCTGGGGGAGGAGATCCAATTCTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Citheronia sepulcralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: This species is still widespread, and not obviously declining, from central Pennsylvania (where it may be increasing) and the New Jersey Pinelands to Florida. However it was apparently extirpated in the mid 20th century (last record in 1952) from Maine, New Hampshire, Massachusetts, Connecticut, Rhode Island, and at least the mainland of New York, almost certainly by some combination of massive (multimillion hectare) gypsy moth spray projects (using mostly DDT) and parasitism by the introduced tachinid Compsilura concinnata. However there has been substantial recovery of large moths, including some Saturniidae, in places like northwestern New Jersey (Dale Schweitzer and others) and northern Vermont and less so the Cape Cod area in New England (Schweitzer, et al., 2011), and one C. sepulchralis was found in Plymouth County, Massachusetts in 2011 (some suspicion this was introduced). Current gypsy moth suppression activities are on a much smaller scale and do not pose a serious threat, probably none at all with spring applications of Btk. There is still some uncertainty about what exactly caused the crash of most large moths in the Northeast several decades ago, that is whether there were factors other than spraying and Compsilura, and about reasons for recovery in some places and not others. Currently there is no evidence C. sepulcralis is continuing to decline. This species is extremely rare or extirpated in about 5-10% of its former range, but usually turns up if looked for and at convenience store lights in southern New Jersey and parts of Pennsylvania, and becomes more common farther south in both the Coastal Plain and mountains. Recent inventory projects in the Virginias have also been getting this species.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Actually increasing in central Pennsylvania apparently but mostly stable in the South (as far north as South Jersey) as far as known, and extirpated northeastward.

Global Long Term Trend: Decline of 30-50%

Comments: This species was actually rather widespread in New England except for Vermont but well into Maine and in southeastern New York and northeastern Pennsylvania and it is extirpated from those areas now and may be also inland south to about the Washington, D.C. area. However that is under 10% of the orignal range and declines in and south of New Jersey have been moderate at worst except probably in parts of Florida. This is still a common moth in much of the South including parts of New Jersey.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Unknown

Comments: This species has been eradicated from about 5% or more of its range (mostly from central Maine to eastern Pennsylvania) almost certainly by an out of control introduced parasitoid, Compsilura concinnata, with massive 1950s-1960s DDT spraying of northeastern forests a contributing factor. That parasitoid is now established in much of the eastern USA but it has had minimal impacts on native Lepidoptera in some places (e.g. southern New Jersey) and greatly reduced wiped out many species of large summer moths in others (e.g. southern New England)--although some are recovering in some places and others persist in very low numbers. Citheronia and Eacles appear to be the most vulnerable genera at least in terms of actual eradication. Until the factors behind these major regional differences in Compsilura impacts are better known it cannot be really determined whether this species is basically unthreatened in much of its range as now appears to be the case or whether it is at high risk of imminent massive reduction. Right now it is thought to be unthreatened in most of its range but that might change very rapidly especially in Appalachia. See Schweitzer (2004) and various references cited. Other threats exist but are localized. It is likely this genus is vulnerable to extreme light polution in large cities but these moths can do well in areas with normal suburban and rural lighting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: See note above. There is no known way to protect any occurrence from Compsilura iif that were to become a problem.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Citheronia sepulcralis

The Pine-devil Moth (Citheronia sepulcralis) is a Nearctic member of the family Saturniidae and of the subfamily Ceratocampinae. The species are blackish-brown coloured.[1]

Range[edit]

The adults fly in broods and can be found in different states of the USA during different months. The moths are present in the states of Georgia, Kentucky, Massachusetts, North Carolina, Pennsylvania, Louisiana, Florida and Maine.[2] They are most common in Florida and Louisiana.[3]

Broods in northern USA will fly during June–July. In the southern states, the moths will fly from April–June. Several broods in Florida City, Florida can fly during March–October.[4]

Status[edit]

Egg[edit]

The eggs hatch after 7–10 days, and the caterpillars then start feeding almost immediately[4]

Larva[edit]

The larvae of the species are black coloured.[5]

Pupa[edit]

As with most of this subfamily, when the caterpillars are ready to pupate, they burrow underground.[4]

Adult[edit]

As with all of Saturniidae, the adults do not feed. Their mouthparts have been reduced. The adults are brown coloured.[5]

Food plants[edit]

Ecology[edit]

Adults emerge in the morning and mate on the same night. Females lay egg in groups of 1-3 on pine needles the next night.[4]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!