Overview

Comprehensive Description

Description of Alexandrium

Goniodomid dinoflagellate, rounded or angular body; cingulum median but displaced by one width on right ventral side; nucleus median and u-shaped; chloroplasts present; some species form chains; many species produce PSP toxins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

biopedia

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 12765 specimens in 20 taxa.
Water temperature and chemistry ranges based on 2422 samples.

Environmental ranges
  Depth range (m): 0 - 500
  Temperature range (°C): -2.058 - 27.590
  Nitrate (umol/L): 0.232 - 14.664
  Salinity (PPS): 24.378 - 39.081
  Oxygen (ml/l): 4.600 - 9.192
  Phosphate (umol/l): 0.071 - 1.268
  Silicate (umol/l): 0.927 - 39.813

Graphical representation

Depth range (m): 0 - 500

Temperature range (°C): -2.058 - 27.590

Nitrate (umol/L): 0.232 - 14.664

Salinity (PPS): 24.378 - 39.081

Oxygen (ml/l): 4.600 - 9.192

Phosphate (umol/l): 0.071 - 1.268

Silicate (umol/l): 0.927 - 39.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alexandrium cf. catenella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACCATTAAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGAAATCTTATCTTTGGATTATTAATCTCAGGTATATCCTCATGTCTCACATCTCTTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATGCCATTATTCCCTTGGGCTCTCTTGATTACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTTTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATTTTACAAAAAATAATCTTTGGGAACCAATCAATGATCTTTGCCATGAGCTGTATTTCTCTTCTTGGAACTGTTGTTTGGGGACATCATATGTATAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alexandrium cf. catenella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Alexandrium

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:148Public Records:82
Specimens with Sequences:122Public Species:16
Specimens with Barcodes:44Public BINs:1
Species:18         
Species With Barcodes:15         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!