Overview
Comprehensive Description
Description of Alexandrium
Goniodomid dinoflagellate, rounded or angular body; cingulum median but displaced by one width on right ventral side; nucleus median and u-shaped; chloroplasts present; some species form chains; many species produce PSP toxins.
Trusted
Ecology
Habitat
Depth range based on 12765 specimens in 20 taxa.
Water temperature and chemistry ranges based on 2422 samples.
Environmental ranges
Depth range (m): 0 - 500
Temperature range (°C): -2.058 - 27.590
Nitrate (umol/L): 0.232 - 14.664
Salinity (PPS): 24.378 - 39.081
Oxygen (ml/l): 4.600 - 9.192
Phosphate (umol/l): 0.071 - 1.268
Silicate (umol/l): 0.927 - 39.813
Graphical representation
Depth range (m): 0 - 500
Temperature range (°C): -2.058 - 27.590
Nitrate (umol/L): 0.232 - 14.664
Salinity (PPS): 24.378 - 39.081
Oxygen (ml/l): 4.600 - 9.192
Phosphate (umol/l): 0.071 - 1.268
Silicate (umol/l): 0.927 - 39.813
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2422 samples.
Environmental ranges
Depth range (m): 0 - 500
Temperature range (°C): -2.058 - 27.590
Nitrate (umol/L): 0.232 - 14.664
Salinity (PPS): 24.378 - 39.081
Oxygen (ml/l): 4.600 - 9.192
Phosphate (umol/l): 0.071 - 1.268
Silicate (umol/l): 0.927 - 39.813
Graphical representation
Depth range (m): 0 - 500
Temperature range (°C): -2.058 - 27.590
Nitrate (umol/L): 0.232 - 14.664
Salinity (PPS): 24.378 - 39.081
Oxygen (ml/l): 4.600 - 9.192
Phosphate (umol/l): 0.071 - 1.268
Silicate (umol/l): 0.927 - 39.813
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Alexandrium cf. catenella
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCACCATTAAGCACTTCTTTCATGAGTTTATCACCTTCAAGTACAGGAAATCTTATCTTTGGATTATTAATCTCAGGTATATCCTCATGTCTCACATCTCTTAACTTTTGGACAACAATTCTAAATCTGAGATCTTATTATCTGACATTAAAGACTATGCCATTATTCCCTTGGGCTCTCTTGATTACAGGAGGAATGCTTTTATTAACATTACCAATCTTATCAGGAGCTTTTCTAATGGTCTTGGCTGATCTTCATTCTAATACACTTTTCTTTGATCCAATCTTTGGAGGAGATCCTATATTCTATCAACACTTATTTTGGTTTTTTGGACATCCAGAAGTTTACATCTTAATAATTCCAGCATTTGGGATCATTAGCATAATAATTTCTGGAATTTTACAAAAAATAATCTTTGGGAACCAATCAATGATCTTTGCCATGAGCTGTATTTCTCTTCTTGGAACTGTTGTTTGGGGACATCATATGTATAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Alexandrium cf. catenella
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Locations of barcode samples
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 148 | Public Records: | 82 |
| Specimens with Sequences: | 122 | Public Species: | 16 |
| Specimens with Barcodes: | 44 | Public BINs: | 1 |
| Species: | 18 | ||
| Species With Barcodes: | 15 | ||
Trusted
Barcode data
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

