Ecology

Habitat

Depth range based on 48 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 1 - 15.2

Graphical representation

Depth range (m): 1 - 15.2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Oecetis (Oecetis trichoptera) is prey of:
Gomphus
Actinopterygii
Rutilus rutilus
Perca flavescens
Micropterus salmoides
Ambloplites rupestris
Pomoxis nigromaculatus
Umbra

Based on studies in:
USA: Iowa, Mississippi River (River)
Finland (Lake or pond, Littoral)
USA: Wisconsin, Little Rock Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Oecetis (Oecetis trichoptera) preys on:
Chironomidae
Psammoryctes
Lumbriculidae
Naididae
Tobrilus
Ironus
Peloscolex
Limnodrilus
Pallasea
Alona
Eurycercus
Alonella
Asellus
Microtendipes
Pseudochironomus
Tanytarsus
Cloeon
Caenis
EphemerAlona affinis
Alona quadrangularis
Alona rustica
Alona intermedia
Alona excisa
Disparalona acutirostris
Chydorus

Based on studies in:
USA: Iowa, Mississippi River (River)
Finland (Lake or pond, Littoral)
USA: Wisconsin, Little Rock Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • C. A. Carlson, Summer bottom fauna of the Mississippi River, above Dam 19, Keokuk, Iowa, Ecology 49(1):162-168, from p. 167 (1968).
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,311Public Records:273
Specimens with Sequences:1,113Public Species:26
Specimens with Barcodes:1,027Public BINs:60
Species:117         
Species With Barcodes:98         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis sp. GC1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. ochracea CHU2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. inconspicua CHU2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis OF sp. MC1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis CJG sp. IN5

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis CJG sp. IN4

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis CJG sp. IN3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis CJG sp. IN2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis XZ sp. AU1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. vulgata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis n. sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oecetis cf. ochracea CHU2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCTATATTTCATTTTTGGTAGATGAGCAGGCCTTCTAGGAACTTCTCTAAGATTACTAATCCGAACAGAACTAGGAACTACTAAATCATTAATTAATAATGATCAAATTTATAATGTTCTTGTAACAGCTCATGCATTTATTATAATTTTCTTTATAGTGATACCAATTATAATTGGAGGATTTGGTAATTGACTAGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCACGTATAAACAACATAAGATTTTGATTATTACCCCCATCATTAAATTTTCTTCTACTAAGAAGAATTGTAGAAAGAGGAACAGGAACAGGTTGAACGGTATACCCACCATTAGCAAGAAATATCGGACACATAGGAAGATCCGTCGATTTATCTATTTTTTCTTTACACATGGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATCACTACATGTTTAAGAATAAAACCTCAAAGAATACTATTAGATCAAATACCTTTATTTGTTTGATCTGTATTAATTACAGCTTTACTTCTATTATTATCATTACCTGTATTAGCTGGAGCTATTACTATACTTCTTACAGATCGAAATTTAAATACATCTTTTTTTGATCCTATAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oecetis cf. ochracea CHU1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCCTATATTTCATTTTTGGTAGGTGAGCAGGCCTTTTAGGAACTTCTCTCAGATTATTAATTCGAACAGAACTAGGAACAACTAAATCATTAATTAACAATGATCAAATTTATAATGTTCTTGTGACAACTCATGCATTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGTTTTGGTAATTGACTAGTACCGTTGATATTAGGAGCCCCTGATATAGCATTTCCACGTATAAACAATATGAGATTTTGATTATTACCTCCATCATTAAACTTTCTTCTATTAAGAAGAATCGTAGAAAGAGGGACTGGAACAGGCTGAACAGTGTACCCCCCATTAGCCAGAAATATTGGGCACATAGGGAGATCTGTTGACTTATCTATTTTTTCTTTACACATAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACATGTTTAAGAATGAAACCTCAAAGAATATTATTAGATCAAATACCTTTATTTGTTTGATCTGTATTAATTACAGCTTTACTTCTACTACTATCATTACCTGTATTAGCTGGAGCCATCACAATACTTCTTACAGATCGAAATCTAAATACATCTTTTTTTGACCCTATAGGAGGGGGAGACCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. ochracea CHU1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oecetis cf. inconspicua CHU2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAAGATGATCAGGATTACTCGGAACTTCTTTAAGAGTTCTAATTCGAACAGAACTAGGAACCACTAAATCTTTAATTAATAATGATCAAATTTATAACGTATTAGTGACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGTAACTGACTTGTCCCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTATTACCTCCTTCTTTAAATTTTTTATTACTCAGAAGTTTAGTAGAAAATGGGACAGGTACCGGTTGAACGGTATACCCCCCATTAGCAAGAAATATTGGGCACATGGGGAGTTCCGTTGATTTATCTATTTTTTCTTTACATATAGCCGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTACAACTTGTTTAAGAATAAAACCAAAAAGAATGCTATTAGATCAAATACCTTTATTCGTATGATCAGTATTAATTACTGCATTACTATTACTTCTTTCTTTACCAGTTTTAGCCGGAGCAATTACTATATTACTAACGGACCGGAATTTAAATACATCTTTTTTTGACCCAGCAGGTGGTGGAGACCCTATCTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Oecetis cf. inconspicua CHU1

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAAGATGAGCTGGATTACTCGGAACATCATTAAGAGTTCTAATTCGAACAGAACTAGGAACTACTAAGTCTCTAATTAATAATGATCAAATTTATAACGTATTAGTAACTGCCCATGCTTTTATCATGATTTTTTTCATAGTGATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCACTAATACTCGGGGCCCCAGATATAGCATTCCCGCGAATAAATAATATAAGATTTTGACTCCTTCCCCCCTCTTTAAATTTTTTACTTCTTAGAAGGTTAGTAGAAAATGGTACAGGAACCGGTTGAACTGTTTATCCGCCATTAGCGAGAAATATCGGACATATGGGAAGCTCTGTTGATCTTTCAATTTTTTCCTTACATATAGCTGGGATTTCTTCTATTCTAGGAGCTATTAATTTTATTACAACTTGTATAAGAATAAAACCAAAAAGAATACTTTTAGACCAAATACCCTTATTTGTTTGATCAGTATTAATTACAGCTTTACTACTACTTCTATCTTTACCAGTTTTAGCCGGAGCTATCACTATATTACTTACAGACCGAAACCTAAATACATCTTTTTTTGACCCAGCAGGAGGCGGAGACCCCATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. inconspicua CHU1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis n. sp. 1 CR

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oecetis cf. ochracea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Oecetis

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!