Overview

Brief Summary

The Polyphemus moth (Antheraea polyphemus) is a North American member of the family Saturniidae, the giant silk moths. It is widespread from locations even in northern Canada to parts of Mexico. Adult moths have tan colored wings with an average wingspan of 15 cm. The combination of its wing coloring and its unusual clear-centered eyespots on fore- and hind-wings make it very distinctive and easily identifiable. The eye spots inspire its name – from the Greek myth of the Cyclops Polyphemus. The bright green caterpillar looks similar to that of the Luna moth (Actias luna, also a saturnid). The adult moth does not have mouthparts and cannot feed, but the caterpillar eats huge amounts over the two months between hatching and pupating. Favored plants include oak, hickory, elm, maple and birch; caterpillars will also eat apple, beech, ash, willow, linden, rose, grape and pine. This species overwinters as a pupa inside a 7-8 cm long spindle-shaped cocoon, which is cemented to a tree branch or twig of the host plant.

(Bessin 2004; Kalola and Steffy 2011; Wikipedia 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

General Description

No other species can be confused with this distinctive moth. The tan colouration with the transparent eyespots on the fore- and hindwings are unique. There is some variation in the ground colour of the wings, with some individuals tending to a darker grey-tan and little or no pink band on the outside of the subterminal line.
D. Macaulay image and Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Polyphemus moths, Antheraea polyphemus, can be found in all of the continental United States except Arizona and Nevada and in every Canadian province except Newfoundland and Prince Edward Island.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The polyphemus is the most widely distributed silkmoth in North America, occuring coast to coast in southern Canada and the U.S., south to Arizona. Known as far north as Zama City in extreme northwestern Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Polythemus moths, as caterpillars, are bright green with a reddish brown head. They have 6 orange tubercles and bristles on each segment of their body. Each abdomen segment has a slanted yellow line that is purple-brown in color. Caterpillars can grow to about 7 cm in length.

As adults, members of this species are large moths. Polythemus moths have a hairy body, and adults can vary from red-brown to dark brown in color. Each hind wing has a large yellow “eyespot” lined with blue and black. The center of this eyespot is uniquely transparent. The front wings have a smaller yellow spot. The margin of both the front and hind wings has a black and white stripe. Wingspan ranges from 10 to 15 cm. Whereas adult males have bushy antennae for detecting pheromones, females have slender antennae.

Polyphemus moth caterpillars greatly resemble caterpillars of luna moths. While polyphemus moths have single horizontal lines along each side of the body, luna moths have vertical yellow lines on each segment.

Range length: caterpillar 7 (high) cm.

Range wingspan: 10 to 15 cm.

Sexual Dimorphism: sexes alike

Other Physical Features: ectothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Polyphemus moths inhabit deciduous hardwood forests, urban areas, orchards, and wetlands.

Habitat Regions: temperate

Terrestrial Biomes: forest

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Deciduous boreal forest in central and northern AB, local in the parkland and prairie river valleys.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Caterpillars feed on leaves of broad-leaved trees and shrubs such as sweetgum (Liquidambar), birch (Betula), grape (Vitis), hickory (Carya), maple (Acer), oak (Quercus), willow (Salix), and members of the rose family (Rosaceae). Larvae also eat their egg shells after hatching and their freshly molted skin. A caterpillar eats 86,000 times its body weight. Adult moths have a reduced mouth and do not eat.

Plant Foods: leaves

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

McGugan (1958) reports larval collections from 26 different trees and shrubs, but over half of the records were obtained from White Birch (Betula papyrifera). Larvae also feed on Trembling Aspen, Red Osier Dogwood, and occasionally Pin- and Choke Cherry, Hawthorn, and Serviceberry. Other confirmed host plants in AB are willows (Salix bebbiana and Salix discolor).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Polyphemus moths act as prey for certain insects, raccoons, and squirrels. They are also parasitized by some wasps. Because they consume a large quantity of leaves, they may also considerably contribute to nutrient cycling.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Polyphemus moth caterpillars are preyed upon by yellowjackets and ants. They are also parasitized by wasps. Larvae and pupae are consumed by raccoons and squirrels. The green coloration of caterpillars makes them difficult to spot. Adults also practice mimicry; they have eyespots on their hind wings.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

When ready to mate, female polyphemus moths emit pheromones that attract males. Males use their sense of smell and touch to find females. Although larvae (caterpillars) have eyes, they are small and primitive, resulting in poor vision.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Adults are found primarily from late May to late June.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

After about 10 days, tiny polyphemus moth caterpillars hatch from eggs. Larvae (caterpillars) molt 5 times and grow to their full size in 5 to 6 weeks. When caterpillars are fully grown, they wrap themselves in a leaf and build a cocoon out of silk. Cocoons are oval in shape, 40 mm in length and 22 to 24 mm in diameter. While in a cocoon, a caterpillar develops into a pupa and then emerges as an adult moth in about 2 weeks. Polyphemus moths can also overwinter in their cocoons, which increases time as pupae.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Overwinters as a pupa in a large, silken cocoon. Although the oval-shaped cocoons usually fall to the ground with the host plant leaves they are wrapped in, they can occasionally be found in the winter still attached to the host plant by a small amount of silk thread. These moths typically rest suspended from a branch or twig during the day, with their wings folded above their back. The undersides of the wings are surprisingly cryptic for such a large moth. If these moths are disturbed when at rest, they often drop to the ground, and flap their wings once giving the appearance of a sudden 'jump'. With the eyespots exposed, this makes an impressive display which may startle potential predators. Polyphemus was a giant cyclops in greek mythology, and the polyphemus moth presumably received its name to reflect the large eyespots on its wings.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

As adults (moths), polyphemus moths live a maximum of only 4 days. Their entire life cycle averages about 3 months in length. This includes about 10 days as eggs, 5 to 6 weeks as larvae, 2 weeks as pupa, and about 4 days as adults. If they overwinter as pupa, this life cycle increases in length.

Average lifespan

Status: wild:
3 months.

Average lifespan

Status: captivity:
3 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Popyphemus moths mate the same day that they emerge from their cocoons, and mating usually occurs during late afternoon. Females emit pheromones, which can be detected up to a mile away, to attract mates. Mating of saturniids can last from less than an hour to many hours. Females lay their eggs shortly after mating. If unsuccessful in recruiting a male after 2 or 3 days, females stop calling and release their unfertilized eggs.

Mating System: polygynous

Female polyphemus moths begin to emerge and mate during early spring. Females lay up to 5 eggs singly or in groups of 2 or 3 on the underside of tree leaves. Eggs are flat and round, cream to light tan in color on top with a brown outline, and are about 1.25 mm thick and 3 mm in diameter. In most regions, 2 broods of polyphemus moths hatch per year; one hatches in early spring and the other in late summer. However, in the northernmost part of their range, only one brood hatches per year. In the southern part of their range, many broods may hatch each year.

Breeding interval: Polyphemus moths breed once in their lifetime.

Breeding season: Polyphemus moths breed in early spring or summer.

Range eggs per season: 1 to 5.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Female polyphemus moths usually lay their eggs on leaves that are a good food source for the caterpillars. They are not otherwise involved in the rearing of their offspring.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antheraea polyphemus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGCACTTCTTTAAGACTTCTAATTCGAGCAGAATTAGGAACCCCCGGGTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATATTAGGAGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGTTTTTGGTTATTACCCCCTTCTTTAACTCTTTTAATTTCGAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACAGTTTACCCACCTTTATCCTCTAATATCGCTCATGGAGGATCATCTGTTGATCTTGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATAAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCTTTCTTACTTCTTTTATCTTTACCTGTATTAGCAGGAGCAATTACTATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGTGGTGGAGACCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antheraea polyphemus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Polyphemus moths have not been evaluated or are not considered threatened by the IUCN, US Fish and Wildlife Service or CITES.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although there is some variation in the year-to-year abundance of this species, it is usually common
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Polyphemus moth caterpillars are occasionally considered pests to plum orchards in California.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no known direct positive effects of polyphemus moths on humans, though many are hand-raised by curious individuals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Antheraea polyphemus

The polyphemus moth (Antheraea polyphemus) is a North American member of the family Saturniidae, the giant silk moths.[1] It is a tan-colored moth, with an average wingspan of 15 cm (6 in). The most notable feature of the moth is its large, purplish eyespots on its two hind wings. The eye spots give it its name – from the Greek myth of the Cyclops Polyphemus. The species is widespread in continental North America, with local populations found throughout subarctic Canada and the United States. The caterpillar can eat 86,000 times its weight at emergence in a little less than two months.

Lifecycle[edit]

The lifecycle of the moth is much like that of any other Saturniidae species. It lays flat, light-brown eggs on the leaves of a number of host plants, including:

Antheraea polyphemus caterpillar, early November, in Virginia, USA

When the eggs hatch, small yellow caterpillars emerge. As the caterpillars age, they molt five times (the fifth being into a pupa). Each instar is slightly different, but on their fifth and final instar, they become a bright green color with silver spots on their sides. They feed heavily on their host plant and can grow up to 3–4 in long. They then spin cocoons of brown silk, usually wrapped in leaves of the host plant.

Two broods generally hatch each year throughout the United States, one in early spring and one in late summer. The moths eclose and then must pump their wings with fluid (hemolymph) to extend them. The females emit pheromones, which the male can detect through his large, plumose antennae. Males can fly for miles to reach a female. After the moths mate, the female spends the majority of the remainder of her life laying eggs, while the male may mate several more times. Adults of this family of moths have vestigial mouths, meaning their mouth parts have been reduced. Because of this, they do not eat and only live as adults for less than one week. In captivity, this moth is much more difficult to breed than other American saturnids such as the cecropia, promethean, or luna. Kept in a cage, the male and female tend to ignore each other, unless a food plant (particularly oak leaves) is present.

Sexual dimorphism[edit]

Differentiating between sexes of this species is very easy. The most obvious difference is the plumose antennae. Males have very bushy antennae while females have moderately less bushy antennae. The male's antennae are used to detect pheromones released by unmated females. Another difference is that the females are slightly larger in the abdomen due to carrying eggs. A surprising amount of variation occurs within this species. Color patterns can range from a reddish-cinnamon to a dark brown, but are almost always a shade of brown. In the late 1950s, amateur lepidopterist Gary Botting hybridized the polyphemus moth (then known as Telea polyphemus) with Antheraea yamamai from Japan and, later, Antheraea mylitta from India by transferring the pheromone-producing scent sacs from female "T. polyphemus" to the Antheraea females and allowing T. polyphemus males to mate with them. The resultant hybrids were displayed in his winning U.S. National Science Fair exhibit "Intergeneric hybridization among giant silk moths."[2] After Botting consulted with genetic statistician J.B.S. Haldane and his wife, entomologist Helen Spurway, the polyphemus moth was reclassified, becoming Antheraea polyphemus.

Gallery[edit]

Threats[edit]

Pests of the moths have become a huge problem. Parasitic insects such as some species of wasps and flies lay their eggs in or on the young caterpillars. The eggs then hatch into larvae which consume the insides of the caterpillars. Once the caterpillars pupate, the larvae themselves pupate, killing the polyphemus pupa. Squirrels have also been known to consume the pupae of polyphemus moths, decreasing the population greatly. Pruning of trees and leaving outdoor lights on at night can also be detrimental to the moths.

Response to threats[edit]

The polyphemus moth uses defence mechanisms to protect itself from predators. One of its most distinctive mechanisms is a distraction pattern that serves to confuse, or simply distract, predators. This involves the large eyespots on its hind wings, which give the moth its name (from the Cyclops Polyphemus in Greek mythology). Eyespots are also startle patterns, a subform of distraction patterns, used for camouflage via deceptive and blending coloration. Most startle patterns are brightly colored areas on the outer body of already camouflaged animals. (Another example of the use of startle patterns is the gray tree frog, with its bright-yellow leggings. When it leaps, a flash of bright yellow appears on its hind legs, usually startling the predator away from its prey.) Distraction patterns are believed to be a form of mimicry, meant to misdirect predators by markings on the moths' wings. The pattern on the hind wings of the polyphemus moth resembles that on the head of the great horned owl (Bubo virginianus).

In literature[edit]

In An American Childhood, Annie Dillard uses the constraint and subsequent crippling of a newly emerging polyphemus moth as a metaphor for thwarted human potential.

In film[edit]

In Peter Jackson's The Lord of the Rings: The Fellowship of the Ring, a polyphemus moth is the messenger between Gandalf and Gwaihir.

In music[edit]

In "John's Cocoons", singer/songwriter Michael McNevin describes the lifecycle of the polyphemus moth

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Most workers have included what is now A. occulea under this name.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!