Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1831 specimens in 94 taxa.
Water temperature and chemistry ranges based on 1155 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): -0.359 - 29.325
  Nitrate (umol/L): 0.006 - 44.880
  Salinity (PPS): 31.235 - 38.698
  Oxygen (ml/l): 0.303 - 7.464
  Phosphate (umol/l): 0.006 - 3.294
  Silicate (umol/l): 0.693 - 178.507

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): -0.359 - 29.325

Nitrate (umol/L): 0.006 - 44.880

Salinity (PPS): 31.235 - 38.698

Oxygen (ml/l): 0.303 - 7.464

Phosphate (umol/l): 0.006 - 3.294

Silicate (umol/l): 0.693 - 178.507
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Octopus (octopuses) is prey of:
Scorpaena guttata
Scorpaenichthys marmoratus
Chondrichthyes
Scombridae
Actinopterygii
phytoplankton
Octopus
Decapoda
Stomatopoda
Anomura

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)
Puerto Rico, Puerto Rico-Virgin Islands shelf (Reef)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
  • Opitz S (1996) Trophic interactions in Caribbean coral reefs. ICLARM Tech Rep 43, Manila, Philippines
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Octopus (octopuses) preys on:
Actinopterygii
decomposers/microfauna
phytoplankton
organic stuff
Octopus
Decapoda
Stomatopoda
Anomura
Gastropoda
Scaphopoda
Neoloricata
Priapula
Polychaeta
Ophiuroidea
Bivalvia

Based on studies in:
Puerto Rico, Puerto Rico-Virgin Islands shelf (Reef)

This list may not be complete but is based on published studies.
  • Opitz S (1996) Trophic interactions in Caribbean coral reefs. ICLARM Tech Rep 43, Manila, Philippines
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Octopus sp. NSMT-Mo.75218

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATTTTATTTTTGGAATTTGATCAGGATTATTAGGAACATCATTA---AGATTAATAATCCGAACAGAACTAGGTCAACCAGGATCTCTTCTAAACGAC---GATCAATTATATAATGTTATCGTAACAGCTCATGCATTTGTAATAATTTTTTTTCTTGTTATACCCGTTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATA---CTAGGAGCCCCCGATATAGCTTTTCCCCGAATGAATAATATAAGATTCTGACTTCTTCCCCCTTCATTAACATTACTCCTATCTTCAGCTGCAGTCGAAAGAGGTGTGGGAACTGGATGAACTGTATACCCTCCACTCTCAAGAAATTTAGCTCATATAGGGCCCTCAGTTGATCTT---GCTATTTTTTCTCTTCATTTAGCAGGAATTTCATCAATTCTTGGAGCCATTAATTTCATTACTACTATTATTAATATACGATGAGAAGGAATACTAATAGAACGATTACCTTTATTTGTTTGATCTGTATTTATTACAGCAATCTTATTACTTCTATCACTTCCAGTTTTAGCAGGT---GCAATTACTATACTATTAACTGACCGAAATTTCAATACAACATTTTTTGATCCAAGAGGAGGGGGAGACCCAATCTTATATCAACATTTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus sp. NSMT-Mo.75218

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Octopus sp. OM949

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATTTTATTTTCGGAATTTGATCAGGTCTTTTAGGTACCTCATTAAGATTAATAATTCGTACTGAACTAGGCCAACCAGGATCACTTCTTAATGAT---GACCAACTTTATAATGTAATTGTAACTGCACATGCATTCGTAATAATTTTTTTTCTTGTTATACCTGTAATAATTGGAGGATTTGGAAATTGACTAGTCCCCTTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGTTTCTGACTTCTCCCTCCTTCCTTAACCCTGCTACTGACTTCACCACCAGTGGAAAGAGGAGTAGGAACAGGATGAACTGTATATCCCCCTCTATCAAGTAACCTTGCTCACACAGGGCCTTCTGTTGATTTAGCAATTTTTTCACTCCATTTAGCCGGAATCTCATCCATTTTAGGAGCTATTAACTTTATCACCACTATTATTAATATACGATGAGAAGGAATACAAATAGAACGTCTTCCTTTATTTGTTTGATCAGTATTTATTACTGCTATTCTCCTTCTCTTATCATTACCTGTTCTCGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTCAATACCACTTTTTTTGATCCAAGGGGAGGAGGAGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus sp. OM949

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Octopus sp. OM853

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATTTTATTTTCGGAATTTGATCAGGTCTTTTAGGTACCTCATTAAGATTAATAATTCGTACTGAACTAGGCCAACCAGGATCACTTCTTAATGAT---GACCAACTTTATAATGTAATTGTAACTGCACATGCATTCGTAATAATTTTTTTTCTTGTTATACCTGTAATAATTGGAGGATTTGGAAATTGACTAGTCCCCTTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGTTTCTGACTTCTCCCTCCTTCCTTAACCCTGCTACTGACTTCAGCAGCAGTGGAAAGAGGAGTAGGACCAGGATGAACTGTATATCCCCTTCTATCAAGTACCCTGGCTCACACAGGGCTTTCTGGTGATTTAGCAATTTTTTCACTCCATTTAGCGGGAATCTCATCCATTTTAGGAGCTATTAACTTTATCACCACTATTATTAATATACGATGAGAAGGAATACAAATAGAACGTCTTCCTTTATTTGTTTGATCAGTATTTATTACTGCTATTCTCCTTCTCTTATCATTACCTGTTCTCGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTCAATACCACTTTTTTTGATCCAAGGGGAGGAGGAGACCCAATTCTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus sp. OM853

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 53
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus cf. bocki

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Octopus ocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGAATATTTTCAACAAATCATAAAGACATTGGTACATTATACTTTATCTTCGGAATTTGATCAGGCCTCCTAGGTACATCTTTAAGCTTAATAATTCGAACAGAATTAGGTCAACCAGGATCTTTATTAAATGAT---GATCAATTATATAATGTAATTGTTACAGCCCATGCATTTGTAATAATTTTTTTTTTGGTTATACCTGTTATAATTGGAGGATTTGGTAACTGATTAGTCCCCTTAATATTAGGTGCTCCAGATATAGCTTTTCCTCGTATAAATAATATAAGATTCTGATTATTACCTCCCTCTCTTACTTTATTACTTTCCTCAGCTGCGGTAGAAAGAGGAGCTGGTACTGGATGAACTGTCTATCCACCTCTATCAAGTAATTTAGCTCATATAGGACCCTCCGTCGATTTAGCTATTTTCTCCTTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTTGAGAAGGAATATTAATAGAACGACTCCCTTTATTTGTATGATCTGTCTTTATTACAGCTGTTTTATTACTTCTTTCACTACCAGTACTTGCTGGTGCAATCACTATACTTTTAACTGATCGAAATTTCAACACAACTTTTTTTGACCCAAGAGGAGGAGGTGACCCTATCCTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCCCATATTGTTTCCCATTATTCTATAAAAAAAGAAACATTTGGTAGATTAGGAATAATTTATGCTATATTATCTATTGGGTTATTAGGATTTATTGTATGAGCCCATCATATATTTACAGTTGGAATAGATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus ocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Octopus sp. OM870

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATTTTATTTTTGGAATTTGATCAGGTTTACTAGGTACATCATTAAGATTAATAATTCGAACAGAACCAGGACAACCTGGATCTCTATTAAATGAT---GATCAACTTTATAACGTCATTGTTACTGCCCACGCTTTTGTAATAATTTTCTTCCTAGTTATACCCGTAATAATTGGAGGATTTGGAAACTGATTGGTTCCCTTAATATTGGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTACTTCCTCCCTCTTTAACTCTTCTTTTAACCTCAGCAGCAGTAGAAAGAGGAGCAGGAACAGGCTGAACTGTATATCCACCATTATCTAGAAATTTAACTCATATAGGACCATCTGTAGATCTAGCCATTTTTTCTCTTCACTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGATGAGAAGGGATACAAATAGAACGTCTTCCTTTATTTGTATGATCTGTTCTAATTACAGCAATTCTACTTCTATTATCTTTACCAGTATTAGCAGGGGCAATTACCATACTTCTTACTGACCGTAATTTCAACACAACTTTTTTTGATCCTAGAGGAGGAGGAGATCCTATTTTATACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus sp. OM870

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Octopus cf. wolfi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 410
Specimens with Sequences: 377
Specimens with Barcodes: 370
Species: 37
Species With Barcodes: 35
Public Records: 126
Public Species: 27
Public BINs: 31
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Octopus (genus)

Octopus is the largest genus of octopuses, comprising more than 100 species. These species are widespread throughout the world's oceans. Many species formerly placed in the genus Octopus are now assigned to other genera within the family Octopodidae.[1]

Species[edit]

The species listed above with an asterisk (*) are questionable and need further study to determine if they are valid species or synonyms.[6]

References[edit]

  1. ^ Gofas, S. (2013). "Octopus Cuvier 1798". World Register of Marine Species. Retrieved 31 March 2014. 
  2. ^ Kaneko, N. & Kubodera, T. (2008). "Two new species of pygmy octopuses (Cephalopoda: Octopodidae) from deep water off the Ryukyu Archipelago, southern Japan." Molluscan Research 28(3): 145–157.
  3. ^ a b c Huffard, C.L. (2007). Four new species of shallow water pygmy octopus (Mollusca: Cephalopoda) from the Kingdom of Tonga. Molluscan Research 27(3): 147–170.
  4. ^ Octopus hummelincki Adam, 1936 (Mollusca, Cephalopoda): specific name conserved
  5. ^ Leite, T. S.; Haimovici, M.; Molina, W.; Warnke, K. (2007). "Morphological and genetic description of Octopus insularis, a new cryptic species in the Octopus vulgaris complex (Cephalopoda: Octopodidae) from the tropical southwestern Atlantic". Journal of Molluscan Studies 74 (1): 63–74. doi:10.1093/mollus/eym050.  edit
  6. ^ Sweeney, M.J. (2001). Current Classification of Recent Cephalopoda. PDF - updated May 4, 2001. 59 pp.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Pinnoctopus

Pinnoctopus is a genus of octopuses in the family Octopodidae.

Species

Taxonomic note

ITIS treats Pinnoctopus as a synonym of Octopus Cuvier, 1797.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!