Molecular Biology and Genetics

Molecular Biology

Barcode data: Cauchas fibulella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTCTTTTTTGGAATTTGATCAGGATTATTAGGAACTTCTTTAAGATTACTAATTCGAACAGAATTAGGAATACCTGGGTCTTTAATTGGGAATGATCAAATTTATAACACAATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCCTTTCCTCGACTTAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATTTCAAGAAGATTAGTAGAAAATGGATCAGGAACTGGTTGAACAGTTTATCCCCCATTATCAAGAAATATTTCACATTCAGGTACTTCTGTAGATTTAACAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTGTAATTAATATACGAACAATAAATATAACATTTGATCAAATATCATTATTTACCTGATCAGTAGCTATTACAGCATTATTATTATTATTATCCTTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAACACCTCATTCTTTGATCCAATAGGAGGAGGAGATCCTATTTTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cauchas fibulella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cauchas fibulella

Cauchas fibulella is a day-active moth of the Adelidae family. It is known from most of Europe, although there are no records from Portugal, Ireland, Iceland, most of the Balkans, Belarus, southern Russia and the Mediterranean Islands.

A sprig of Veronica chamaedrys with larva cases
Larva
Adult

The wingspan is 8-8.5 mm for males and 7.9-8.6 for females. The wings are red-brown with a metallic glow. There is a yellow band and yellow spot located on the forewing. Adults are on wing from May to June.

The larvae feed on Veronica chamaedrys and Veronica officinalis. They start feeding on the seeds. Later, they build a portable case from fragments of plant and start feeding on the leaves close to the ground.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!