Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Comprehensive Description

Gen. Myrmica HNS .

Gen: Char: Antennae sufficiently exposed; head triangular, without spines; maxillary, palpi long, of six joints; jaws triangular; three cubital cells in the upper wings, the third incomplete, & c. Such are the characters assigned to this genus by modem authors. Whether the following species all belong to it or not I cannot de-tide, but judging from their differences I imagine that they form at least three groups.

In the first group I shall place two or three nearly allied species, one of which has already been described by Col. Sykes as a Myrmica HNS , as that this may be considered the typical group. Of this I have what I imagine to be three species, but all very closely allied to each other.

  • Jerdon, T. C. (1851): A catalogue of the species of ants found in southern India. Madras Journal of Literature and Science 17, 103-127: 113-113, URL:http://antbase.org/ants/publications/4764/4764.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

2. MYRMICA HNS Latr.

Zett. Lepel. S: t Farg. Dahlb. Losana.

Corpus parvae vel minutae staturae. Palpi minimi *); maxillares articulis 6, apice sensim acutiusculi; maxillares articulis 4, ultimo crassiori, subclavaeformi, ovato. Nodi petioli abdominalis (in nostris speciebus) bini, anterior subtus ad metasteruum spinula parva obtusiuscula. Abdominis segmentum primum maximam abdominis partem occupante.

Operaria: mare et femina minor, formatione capitis ejusque, partium ut feminae, praeter quod nulla habet stemmata. Thorax plus minus striatim aut rugose insculptus, capite semper nonnihil gracilior, postice parum angustior, dorso inter meso- et metathoracem saepissime paulum immerso; metathorax spinis utrinque (in nostris speciebus). Abdomen ovatum longitudine capitis vel saepissime parum longius, politum, segmento primo saltem 3 / 4 totius abdominis occupante. Aculeata.

Femina: operaria et plerumque - mare paullo major, capite thoraceque sicut in operaria plus minus striatim vel rugose insculptis. Antennae 12 vel 11 - articulatae (praeter radiculam), scapo tertiam partem totius antennae excedente; flagellum pedicello obconico, arliculis 3 vel 4 ultimis crassis clavara fere formantibus, ceteris moniliformibus versus apicem sensim parum incrassatis. Mandibulae latae validae apice denticulato. Ocelli distincti. Thorax masis tumidus quam in operaria. Alae longitudine corporis vel paullo longiores, area discoidali una et cubitalibus biuis vel una; area cubitali prima vel nervum dividentem includeute vel integra, area cubitali secunda ob nervos eandem formaturos evanescentes obsolete indicala vel nulla. Abdomen fere ut in operaria. Aculeata.

Mas: Caput minus et brevius quam feminae. Mandibulae vel parum denticulatae vel obtusae, semper debiliores quam in femina. Antennae articulis 13, 12 vel 10; scapus vel tertiae partis totius antennae vel brevior aut brevissimus. Oculi magis prominuli quam in operaria et femina; ocelli magni. Thorax gibbosus; prothorax angustus, humilis; mesothorax valde elevatus, per lineas impressiusculas binas saepe crenalas, a latere infero (pleurali) utrinque in discum mesonoti conniventer ductas ibique angulo sat aculo se jungentes, in portiones tres, unam mediam anticam et binas laterales posteriores, partitus; metathorax tantum tuberculis utrinque subangulatis vel nullis. Abdomen politum segmento primo vix 2 / 3 totius efficiente; genitalia fere abscondita.

  • Nylander, W. (1846): Adnotationes in monographiam formicarum borealium Europae. Acta Societatis Scientiarum Fennicae 2, 875-944: 925-926, URL:http://antbase.org/ants/publications/4277/4277.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Myrmica HNS Latreille, 1804

Myrmica HNS Latreille, 1804:175.

Type-species: Formica rubra Linne HNS , 1758.

This holarctic genus includes about 70 species of which 10 occur in North Europe. Head oval, clypeus rounded, frontal lobes prominent; alitrunk with pronotum rounded antero-laterally, a well defined mesopropodeal furrow and, in most species, strongly developed propodeal spines. Pedicel with two large nodes - the petiole with a stout antero-ventral tooth and the postpetiole which, rubbed against the fine transverse striae on the first gaster segment, gives an audible stridulation. All tibial spurs are distinctly pectinate except in a very few semi-parasitic species. Gaster in female castes armed with a strong sting. Fore-wing in male and queen have the cubital cell characteristically partially divided by a transverse vein. Palp formula 6, 4; antennae 12 segmented in female caste, 13 in male.

Myrmica HNS ants are robust, deliberate moving, nesting in stumps, under stones or in banks. Colonies are relatively small with individuals numbering from a few hundred to about 5000 according to species. Foraging is on the ground surface.

Keys to species of Myrmica HNS

Workers

1 Antennal scape long and slender, gently curved near the base. Frontal triangle entirely smooth and shining ......................................................................... 2

Antennal scape sharply curved near the base or distinctly angled, with or without a toothlike or lamellar extension at the head ..................................... 3

2 (1) Petiole in profile with large truncate dorsal area, posteriorly with a distinct step down to its junction with the postpetiole. Infra-spinal area transversely striate; petiole nodes rugose; propodeal spines as long as the distance between their tips (Fig. 26) ......................................................... 6. ruginodis Nylander HNS

Petiole in profile with dorsal surface a small rounded dome sloping posteriorly, without a distinct step to its junction with the postpetiole. Infra-spinal area smooth; petiole nodes shining, without rugose sculpture. Propodeal spines shorter than the distance between their tips (Fig. 25)............... 5. rubra (Linne) HNS

3 (1) Antennal scape abruptly curved near the base but never angled nor with la- mellar outgrowth......................................................................................... 4

Antennal scape angled sharply near the base, with or without lamellar exten sion at bend ...................................................................................................... 6

4 (3) Body sculpture including nodes, clypeus and frontal triangle with coarse longi- tudinal rugae; petiole massively domed; propodeal spines rather blunt, incurved and subparallel from above (Fig. 27)................. 12. sulcinodis Nylander HNS

Body sculpture finely striate or rugulose; frontal triangle striate or sculptured apically, only with lower part smooth and shining ................................. 5

5 (4) Head longer than broad with wide frons; petiole smooth, in profile simply angled without a distinct truncated dorsum; postpetiole cubical (Fig. 29) 7. rugulosa Nylander HNS Head not longer than broad, frons narrower with diverging lobes. Petiolus striated, with a distinct truncated dorsal area; postpetiole higher than long. profile (Fig. 28) ............................................................... 3. gallieni Bondroit HNS

6 (3) Antennal scape with a distinct transverse upright flange at bend seen as a tooth- like projection in profile............................................................................... 7

Antennal scape simply angled or with a more or less large lateral lamella and a distinct ridge running forward from the bend.................................................8

7 (6) Frons about 1/4 head width, with small narrow widely diverging lobes to accommodate the large lamelliform flange. Postpetiole in profile low, only slightly higher than long; petiole with rounded antero-dorsal angle, mesopropo- deal furrow shallow (Figs. 31,40)....................................... 10. schencki Emery HNS

Frons about 1/3 head width, with more prominent blunter frontal lobes; lamelliform flange variable, often very large appearing as a distinct vertical tooth in profile. Postpetiole distinctly higher than long in profile, petiole with anterior and dorsal faces meeting at a sharp angle, mesopropodeal furrow deep (Figs. 32,41)......................................................... 4. lobicornis Nylander HNS

Figs . 25-29. Alitrunk in profile of workers of Myrmica HNS - 25: rubra (L.) HNS ; 26: ruginodis Nyl HNS .; 27: sulcinodis Nyl HNS .; 28: gallieni Bondr HNS .; 29: rugulosa Nyl. Scale HNS : 1 mm.

Figs . 30-34. Alitrunk in profile of workers of Myrmica HNS . - 30: specioides Bondr HNS .; 31: schencki Emery HNS ; 32: lobicornis Nyl HNS .; 33: scabrinodis HNS Ny\.; 34: sabuleti Mein HNS . Scale: 1 mm.

8 (6) Petiole in profile with dorsal area curving backward to the junction with the postpetiole without a distinct step. Postpetiole about as long as wide from above, slightly higher than long in profile (ratio 10:8) (Figs. 30, 36) 11. specioides Bondroit HNS

Petiole in profile high with a flattened dome or truncate dorsal area, with a distinct posterior edge falling sharply to the junction with the postpetiole. Postpetiole wider than long from above, clearly higher than long in profile (ratio 10.7).................................................................................................. 9

9 (8) Antennal scape with massively developed lateral extension at bend; petiole in profile a flattened dome (Figs. 34, 39)............................. 8. sabuleti Meinert HNS

Antennal scape simply but sharply angled or with inconspicuous semicircular extension at bend; petiole with distinct truncate dorsal area (Figs. 33,37) 9. scabrinodis Nylander HNS

Queens

1 Antennal scape simply curved near base, without angle or lamellar outgrowth........................................................................................................ 2

Antennal scape bent at an angle near base, with or without a lamellar outgrowth at bend....................................................................................................... 6

2 (1) Antennal scape long and slender, gently curved near the base; frontal triangle entirely smooth and shining.......................................................................... 3

Antennal scape abruptly curved near base; frontal triangle at least in part striated or sculptured................................................................................... 4

3 (2) Propodeal spines long and coarse; infra-spinal area transversely striate; petiole and postpetiole sculptured ................................. 6. ruginodis Nylander HNS

Propodeal spines short; infra-spinal area smooth; petiole and postpetiole shining without sculpture...................................................... 5. rubra (Linne) HNS

4(2) Frontal triangle completely and coarsely striate; petiole in profile an irregular dome......................................................................... 12. sulcinodis Nylander HNS

Frontal triangle in part smooth and shining; petiole either simply angled or clearly truncate in profile............................................................................. 5

5 (4) Postpetiole cubical in profile, not higher than long. Petiole simply angled with very short dorsal area .................................................... 7. rugulosa Nylander HNS

Postpetiole distinctly higher than long in profile. Petiole with distinct truncate dorsal area...................................................................... 3. gallieni Bondroit HNS

6(1) Antennal scape with upright lamelliform flange appearing as a vertical tooth in profile..................................................................................................... 7

Antennal scape either simply angled or with a lateral extension at bend .......... 8

7 (6) Postpetiole distinctly higher than long in profile; frontal ridges not closely approximated, frontal lobes strongly developed; predominant colour brownish black ...................................................................... 4. lobicornis Nylander HNS

Figs . 35-41. Head of Myrmica-workers in antero-dorsal view, except 38, which shows antennal scape insertion in posterior view. - 35: rugulosa Nyl HNS .; 36: specioides Bondr HNS .; 37: scabrinodis Nyl HNS .; 38: same; 39: sabuleti Mein HNS .; 40: schencki Emery HNS ; 41: lobicornis Nyl. Scale HNS : 1 mm.

Postpetiole low in profile; frontal ridges closely approximated with frontal lobes narrow and widely divergent; predominant colour reddish brown 10. schencki Emery HNS

8 (6) Petiole in profile with dorsal surface curving evenly into posterior surface without a distinct posterodorsal edge, narrowly rectangular from above 11. specioides Bondroit HNS

Petiole in profile with dorsal surface flattened and a distinct posterodorsal edge, broadly quadrate from above .............................................................. 9

9 (8) Petiole with anterior and dorsal surfaces meeting at a blunt angle. Antennal scape with a lateral projection at bend and a distinct ridge running forward from the bend ........................................................................................... 10

Petiole with anterior and dorsal surfaces meeting at a sharp angle. Antennal scape simply angled or with small semi-circular extension without a distinct ridge running forward from the bend ........................... 9. scabrinodis Nylander HNS

10(9) Head width 1.15 mm or greater, postpetiole narrower than maximum width across frontal laminae....................................................... 8. sabuleti Meinert HNS

Head width less than 1.12 mm; postpetiole wider than maximum width across frontal laminae................................................................ hirsuta Elmes HNS

Males

1 Antennal scape long, reaching or overreaching occipital border..................... 2

Antennal scape short, not reaching beyond ocelli .......................................... 5

2 (1) Antennae slender with gentle curvature near base; frontal triangle smooth 3

Antennae sharply bent or curved near base; frontal triangle at least in part sculptured................................................................................................... 4

'. 3 (2) Central area of head between frontal ridges longitudinally rugulose. Hind tibiae with long projecting hairs (Fig. 53)................................ 5. rubra (Linne) HNS

Central area of head between frontal ridges smooth. Hind tibiae with sparse short hairs (Fig. 52)....................................................... 6. ruginodis Nylander HNS

4 (2) Mesoscutum in front of notauli rugose; frontal triangle coarsely striated. Antennal scapes simply curved (Fig. 44)....................... 12. sulcinodis Nylander HNS

Mesoscutum in front of notauli smooth; frontal triangle in part smooth. Antennal scape bluntly angled near base (Fig. 45).......................... 4. lobicornis Nylander HNS

5(1) Antennal scapes at least at long as first four funicular segments together (Fig. 50).................................................................................................... 10

Antennal scapes not longer than first three funicular segments together.......... 6

6 (5) Body and appendage hairs abundant and long. Longest hairs are longer than maximum width of hind tibiae (Fig. 55)........................ 9. scabrinodis Nylander HNS

Appendage hairs not as long as maximum width of hind tibiae........................ 7

7 (6) Second funicular segment more than twice as long as wide; scape angled near base (Fig. 51). Median area of head in front of occellus narrowly depressed 10. schencki Emery HNS

Second funiculus segment less than twice as long as wide; scape not angled near base. Dorsum of head without depression.............................................. 8

8 (7) Petiole low with anterior and dorsal faces meeting at a gently rounded obtuse angle. Postpetiole in profile longer than high (Fig. 63)

11. specioides Bondroit HNS

Petiole high with anterior and dorsal faces meeting at a right angle. Postpetiole in profile as high or higher than long.................................................. 9

Figs. 42-51. Antenna of Myrmica HNS -males. - 42: ruginodis Nyl HNS .; 43: rubra (L.) HNS ; 44: sulcinodis Nyl HNS .; 45: lobicornis Nyl HNS .; 46: gallieni Bondr HNS .; 47: rugulosa Nyl HNS .; 48: specioides Bondr HNS .; 49: scabrinodis Nyl HNS .; 50. sabuleti Mein HNS .;51: schencki Emery HNS . Scale: 1 mm.

9 (8) Mesoscutum in front of notauli finely sculptured ............... 3. gallieni Bondroit HNS

Mesoscutum shining without sculpture (Fig. 3).............. 7. rugubsa Nylander

10 (5) Petiole and postpetiole conspicuously hairy with long setae exceeding maximum appendage width (Fig. 68).......................................................... hirsuta Elmes HNS

Petiole and postpetiole with scattered short setae not exceeding maximum appendage width (Fig. 66)................................................. 8. sabuleti Meinert HNS

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 40-48, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

GenusSifolinia HNS Emery, 1907

Sifolinia HNS Emery, 1907:49.

Type-species: Sifolinia laurae Emery HNS , 1907.

Queen. General shape as in Myrmica HNS but antennal scape relatively thick; mid and hind tibiae with pectinate spurs reduced or absent. Both petiole and postpetiole are produced ventrally into blunt projections.

Male. General shape as in Myrmica HNS but lacking mid and hind tibial spurs. Antennae 12 segmented. Postpetiole with a blunt ventral projection, petiole thickened and swollen without defined projection. Notauli with posterior portion of Y tail reduced or absent. Wing venation of Myrmica HNS type but variable and often reduced.

This is a genus of workerless ants parasitic on Myrmica HNS species, with 4 or 5 species known from the palaearctic region only.

  • Collingwood, C. A. (1979): The Formicidae (Hymenoptera) of Fennoscandia and Denmark. Fauna Entomologica Scandinavica 8, 1-174: 58-58, URL:http://antbase.org/ants/publications/6175/6175.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

2. MYRMECINA. HNS

Myrmecina HNS , Curt. Brit. Ent. vi. t 266, 1830. Westw. Int. Class. Ins. Synop. 83,1840.

  • Smith, F. (1851): List of the specimens of British animals in the collection of the British Museum. Part VI. - Hymenoptera Aculeata. London, British Museum: 5-5, URL:http://antbase.org/ants/publications/8200/8200.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus 1. MYRMICA HNS .

Myrmica HNS , Latr. Gen. Crust, et Ins. iv. 131.

The number of joints varying in the different divisions into which the genus is subdivided, the maxillary palpi from 6 to 1, the labial palpi from 4 to 2. Ocelli obsolete in the workers. Females and workers armed with stings; the petiole of the abdomen with two nodes. Pupae usually naked, not enclosed in cocoons, but casting off a thin pellicle on arriving at the perfect condition or imago.

  • Smith, F. (1858): Catalogue of the hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London, British Museum: 114-114, URL:http://antbase.org/ants/publications/8127/8127.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

5 th, Myrmica HNS ,

with sting - abdominal pedicle with 2 knots, jaws triangular, maxillary palpi long.

  • Jerdon, T. C. (1851): A catalogue of the species of ants found in southern India. Madras Journal of Literature and Science 17, 103-127: 104-104, URL:http://antbase.org/ants/publications/4764/4764.pdf
Public Domain

Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Myrmica Latreille HNS

This is a Holarctic genus of ground-nesting ants, with generalized foraging habits. Like most members of the genus, the California species are found predominantly in temperate habitats such as coniferous forests and montane meadows, but one rare species ( M. rugiventris (M. R. Smith)) HNS occurs in chaparral, oak woodland and coastal scrub. A revision of the Nearctic species is in preparation by André Francoeur.

Species identification: keys in Creighton (1950a), Wheeler and Wheeler (1986g) and Mackay and Mackay (2002). Additional references: Bolton (1988a), Evans (1995, 1996a, 1996b), Francoeur (2005), Radchenko (1994a, 1994d), Seifert (1988b), Weber (1939b, 1947b, 1948a, 1950c).

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 34-35, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmica Latreille HNS , 1804

Taxonomy. The genus Myrmica HNS is assigned to the tribe Myrmicini (Bolton 2003). The Vietnamese species were recently revised by Radchenko & Elmes (2001) and Radchenko et al. (2006), and the workers have the following features.

Worker monomorphic; head in full-face view oval; preoccipital carina distinct dorsally and laterally; frontal carina and antennal scrobe absent; anteromedian margin of clypeus weakly convex, lacking an isolated median seta; posteromedian portion of clypeus broadly inserted between frontal lobes; antennae 12-segmented, without distinct club; eye medium sized, convex well laterad; palp formula 6,4; mandible triangular; masticatory margin with apical and 1-2 distinct preapical teeth followed by several smaller teeth or denticles; promesonotum in lateral view slightly raised; promesonotal suture absent or vestigial dorsally; metanotal groove more or less distinctly impressed dorsally; propodeal spine long and sharp; propodeal lobe well developed as a triangular or spinose projection; middle and hind tibiae usually each with a single pectinate spur; petiole pedunculate, with low node; subpetiolar process present as a small tooth anteroventrally; dorsal part of postpetiole in lateral view leaning posterodorsad; gastral shoulder absent; sting well developed, without any apical appendage; head and mesosoma usually strongly reticulate or rugoso-reticulate.

The worker of Myrmica HNS is somewhat similar to those of Aphaenogaster HNS (see under Aphaenogaster HNS ) and Tetramorium HNS . However, in the worker of Tetramorium HNS , the tibial spurs of the middle and hind legs are simple or absent, and the apex of sting bears a small lamellate appendage.

Vietnamese species. Five species have been known from Vietnam: angulata Radchenko & Elmes HNS (Sa Pa); schoedli Radchenko, Elmes & Bui (Sa Pa); serica Wheeler HNS (Sa Pa); titanica Radchenko & Elmes HNS (Sa Pa); yamanei Radchenko & Elmes HNS (Sa Pa).

Bionomics. Myrmica HNS species have so far been found exclusively in the mountains of Fan Si Pan above approximately1,700 m alt. They inhabit sparse to well-developed forests and nest in rotting logs, wood fragments, under stones, in soil around tree bases, etc. Workers forage on the ground and lower vegetation.

  • Eguchi, K., Viet, B. T., Yamane, S. (2011): Generic synopsis of the Formicidae of Vietnam (Insecta: Hymenoptera), Part I - Myrmicinae and Pseudomyrmicinae. Zootaxa 2878, 1-61: 21-21, URL:http://antbase.org/ants/publications/23462/23462.pdf
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmica HNS sp. CA-01

E1 [endemic to California], E2 [endemic to California floristic province (Hickman, 1993)]

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: null, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genus Myrmica Jurine HNS

The Nearctic species of this genus are currently being revised by André Francoeur (pers. comm.). In accordance with his findings Myrmica glacialis Emery HNS is here treated as a valid species ( stat. reval. , stat. nov. ). It was previously considered a synonym of M. lobifrons Pergande HNS .

  • Ward, P. S. (2005): A synoptic review of the ants of California (Hymenoptera: Formicidae). Zootaxa 936, 1-68: 15-15, URL:http://antbase.org/ants/publications/21008/21008.pdf
Public Domain

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomy. The genus Myrmica is assigned to the tribe Myrmicini (Bolton 2003). The Vietnamese species were recently revised by Radchenko & Elmes (2001) and Radchenko et al. (2006), and the workers have the following features.

 

Worker monomorphic; head in full-face view oval; preoccipital carina distinct dorsally and laterally; frontal carina and antennal scrobe absent; anteromedian margin of clypeus weakly convex, lacking an isolated median seta; posteromedian portion of clypeus broadly inserted between frontal lobes; antennae 12-segmented, without distinct club; eye medium sized, convex well laterad; palp formula 6,4; mandible triangular; masticatory margin with apical and 1-2 distinct preapical teeth followed by several smaller teeth or denticles; promesonotum in lateral view slightly raised; promesonotal suture absent or vestigial dorsally; metanotal groove more or less distinctly impressed dorsally; propodeal spine long and sharp; propodeal lobe well developed as a triangular or spinose projection; middle and hind tibiae usually each with a single pectinate spur; petiole pedunculate, with low node; subpetiolar process present as a small tooth anteroventrally; dorsal part of postpetiole in lateral view leaning posterodorsad; gastral shoulder absent; sting well developed, without any apical appendage; head and mesosoma usually strongly reticulate or rugoso-reticulate.

 

The worker of Myrmica is somewhat similar to those of Aphaenogaster (see under Aphaenogaster ) and Tetramorium . However, in the worker of Tetramorium , the tibial spurs of the middle and hind legs are simple or absent, and the apex of sting bears a small lamellate appendage.

 

Vietnamese species. Five species have been known from Vietnam: angulata Radchenko & Elmes (Sa Pa); schoedli Radchenko, Elmes & Bui (Sa Pa); serica Wheeler (Sa Pa); titanica Radchenko & Elmes (Sa Pa); yamanei Radchenko & Elmes (Sa Pa).

 

Bionomics. Myrmica species have so far been found exclusively in the mountains of Fan Si Pan above approximately1,700 m alt. They inhabit sparse to well-developed forests and nest in rotting logs, wood fragments, under stones, in soil around tree bases, etc. Workers forage on the ground and lower vegetation.

License not applicable

Eguchi, K.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

E1 [endemic to California], E2 [endemic to California floristic province (Hickman, 1993)]

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This is a Holarctic genus of ground-nesting ants, with generalized foraging habits. Like most members of the genus, the California species are found predominantly in temperate habitats such as coniferous forests and montane meadows, but one rare species ( M. rugiventris (M. R. Smith)) occurs in chaparral, oak woodland and coastal scrub. A revision of the Nearctic species is in preparation by André Francoeur.

 

Species identification: keys in Creighton (1950a), Wheeler and Wheeler (1986g) and Mackay and Mackay (2002). Additional references: Bolton (1988a), Evans (1995, 1996a, 1996b), Francoeur (2005), Radchenko (1994a, 1994d), Seifert (1988b), Weber (1939b, 1947b, 1948a, 1950c).

License not applicable

Ward, P. S.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zett. Lepel. S: t Farg. Dahlb. Losana.

 

Corpus parvae vel minutae staturae. Palpi minimi *); maxillares articulis 6, apice sensim acutiusculi; maxillares articulis 4, ultimo crassiori, subclavaeformi, ovato. Nodi petioli abdominalis (in nostris speciebus) bini, anterior subtus ad metasteruum spinula parva obtusiuscula. Abdominis segmentum primum maximam abdominis partem occupante.

 

Operaria: mare et femina minor, formatione capitis ejusque, partium ut feminae, praeter quod nulla habet stemmata. Thorax plus minus striatim aut rugose insculptus, capite semper nonnihil gracilior, postice parum angustior, dorso inter meso- et metathoracem saepissime paulum immerso; metathorax spinis utrinque (in nostris speciebus). Abdomen ovatum longitudine capitis vel saepissime parum longius, politum, segmento primo saltem 3 / 4 totius abdominis occupante. Aculeata.

 

Femina: operaria et plerumque - mare paullo major, capite thoraceque sicut in operaria plus minus striatim vel rugose insculptis. Antennae 12 vel 11 - articulatae (praeter radiculam), scapo tertiam partem totius antennae excedente; flagellum pedicello obconico, arliculis 3 vel 4 ultimis crassis clavara fere formantibus, ceteris moniliformibus versus apicem sensim parum incrassatis. Mandibulae latae validae apice denticulato. Ocelli distincti. Thorax masis tumidus quam in operaria. Alae longitudine corporis vel paullo longiores, area discoidali una et cubitalibus biuis vel una; area cubitali prima vel nervum dividentem includeute vel integra, area cubitali secunda ob nervos eandem formaturos evanescentes obsolete indicala vel nulla. Abdomen fere ut in operaria. Aculeata.

 

Mas: Caput minus et brevius quam feminae. Mandibulae vel parum denticulatae vel obtusae, semper debiliores quam in femina. Antennae articulis 13, 12 vel 10; scapus vel tertiae partis totius antennae vel brevior aut brevissimus. Oculi magis prominuli quam in operaria et femina; ocelli magni. Thorax gibbosus; prothorax angustus, humilis; mesothorax valde elevatus, per lineas impressiusculas binas saepe crenalas, a latere infero (pleurali) utrinque in discum mesonoti conniventer ductas ibique angulo sat aculo se jungentes, in portiones tres, unam mediam anticam et binas laterales posteriores, partitus; metathorax tantum tuberculis utrinque subangulatis vel nullis. Abdomen politum segmento primo vix 2 / 3 totius efficiente; genitalia fere abscondita.

License not applicable

Nylander, W.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gen: Char: Antennae sufficiently exposed; head triangular, without spines; maxillary, palpi long, of six joints; jaws triangular; three cubital cells in the upper wings, the third incomplete, & c. Such are the characters assigned to this genus by modem authors. Whether the following species all belong to it or not I cannot de-tide, but judging from their differences I imagine that they form at least three groups.

 

In the first group I shall place two or three nearly allied species, one of which has already been described by Col. Sykes as a Myrmica , as that this may be considered the typical group. Of this I have what I imagine to be three species, but all very closely allied to each other.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

with sting - abdominal pedicle with 2 knots, jaws triangular, maxillary palpi long.

License not applicable

Jerdon, T. C.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Leptothorax Gredleri , Mayr. Form. Austr. 166. 1. Nyl. Form. Fr. et d'Alger. 90 (note).

 

Hab. Austria.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmica , Latr. Gen. Crust, et Ins. iv. 131.

 

The number of joints varying in the different divisions into which the genus is subdivided, the maxillary palpi from 6 to 1, the labial palpi from 4 to 2. Ocelli obsolete in the workers. Females and workers armed with stings; the petiole of the abdomen with two nodes. Pupae usually naked, not enclosed in cocoons, but casting off a thin pellicle on arriving at the perfect condition or imago.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Corpus parva vel minutae staturae. Palpi mtnimi, maxillares articulis sex, apice sensim acutiusculi; labiales articulis quatuor, ultimo crassiori, subclavatformi, ovato. Nodi segmenti primi (petioli abdominalis) bini, segmentum secundum maximam abdominis partem occupans. Operariae et feminae aculeo abscondito.

 

Diese Gattung tritt nicht nur geringer an Zahl der Arten' auf wie die Gattung Formica , sondern auch in Bezug auf die Individuen, welche bei weitem nicht so zahlreich angetroffen werden. Sie leben nicht in größeren Haufen zusammen, sondern fast immer unter Steinen, unter Moos oder in alten Baumstrunken. Obgleich die Arbeiter und Weibchen mit einem Giftstachel versehen sind, so gebrauchen sie ihn doch selten und man kann sie ohne Furcht ergreifen. Bei kühler Temperatur träge , bei warmer Witterung sehr lebendig, trifft man einzelne Arten fast an allen Lokalitäten an, während andere selten sind. Unter den in der Rheinprovinz und namentlich bei Aachen vorkommenden Arten fanden sich mehrere neue, welche hier zuerst folgen mögen .

License not applicable

Förster, A.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Myrmecina , Curt. Brit. Ent. vi. t 266, 1830. Westw. Int. Class. Ins. Synop. 83,1840.

License not applicable

Smith, F.

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / guest
adult of Myrmica karavajevi is a guest in nest of Myrmica

Animal / inquiline
Platyarthrus hoffmannseggi is inquiline in nest of Myrmica
Other: major host/prey

Animal / predator
Tetrao urogallus is predator of adult of Myrmica

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:3477
Specimens with Sequences:3154
Specimens with Barcodes:3046
Species:120
Species With Barcodes:116
Public Records:2484
Public Species:95
Public BINs:114
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica Q. sp. 03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica Q. sp. 02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica Q. sp. 01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica sp. 04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica Qsp.02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica AF-sub

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica AF-smi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica AF-scu

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica AF-mag

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica AF-eva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica cf. nearctica GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCCTCAATAAGAATAATTATTCGCCTAGAACTAGGATCTTGTAATTCACTAATTAATAAT---GACCAAATTTATAACACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTCATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAATTCCCTTAATA---TTAGGATCTCCTGATATAGCTTACCCTCGTATAAATAACATAAGATTTTGACTCCTCCCTCCCTCAATCATATTACTAATATTAAGAAATTTCCTAAGGAACGGTGTAGGAACCGGCTGAACAATTTATCCCTCCATAGCTTCTAATGTTTTTCACAGAGGCCCCTCAATTGATATATCA---ATCTTCTCTCTACATATAGCAGGAATGTCTTCAATTCTCGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCCCTAATAGTATGATCAATTATAATTACAGCAGTACTTCTCCTCCTTTCCCTWCCAGTTTTAGCAGGA---GCAATTACCATGCTTCTCACAGATCGAAACTTAAATACATCATTTTTTGACCCCTCAGGAGGGGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTCTATATTTTAATCTTACCAGGATTTGGTCTAATTTCTCATATTATTATAAGAGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTTGGAATAATTTATGCTATAATTGCAATTGGATTTTTAGGATTTATTGTCTGAGCACATCATATATTTACAATTGGACTAGATGTGGATACCCGAGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCTACAGGCATTAAAATTTTTAGATGAATTTCT---ACTCTTCACGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica cf. nearctica GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 1 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCATCTATAAGAATAATTATTCGCTTAGAACTTGGCTCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACAATTGTAACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGGTTTGGAAATTTTTTAATTCCCTTAATA---TTAGGATCACCTGATATAGCCTATCCTCGAATAAATAATATAAGATTCTGACTTCTACCTCCTTCAATCACATTATTAATATTAAGAAATTTTTTAAGAAATGGAGTTGGTACAGGATGAACTATTTATCCCCCTTTAGCCTCTAATATTTTTCATAGAGGACCTTCAGTCGATATATCA---ATTTTTTCTCTTCATATAGCCGGAATATCTTCAATTCTAGGAGCTATTAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAATTCCTTTAATAGTCTGATCAATTTTAATTACTGCAATTCTTCTTCTTCTTTCTCTACCCGTCCTTGCAGGA---GCAATTACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTTGACCCATCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTCTTTGGACATCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACCTTTGGATCTCTTGGAATAATCTATGCTATAATTGCTATTGGATTTTTAGGTTTTATTGTTTGAGCTCATCATATATTCACAATTGGATTAGATGTAGATACCCGAGCATATTTTACTTCAGCAACTATAATTATTGCTATTCCCACAGGTATTAAAATTTTTAGATGAATTTCA---ACTCTTCATGGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 1 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 6 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATAATTATTCGTTTAGAATTAGGTTCTTGTAATTCATTAATCAATAAT---GATCAAATTTATAATACTTTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAATTCCCTTAATA---TTAGGTTCTCCTGATATAGCCTATCCTCGTATAAATAATATAAGATTTTGGCTTCTCCCTCCTTCAATCATATTATTAATATTAAGAAATTTCTTAAGAAATGGAGTAGGAACAGGCTGAACAATTTATCCTCCATTAGCCTCCAATATTTTCCATAGAGGCCCATCAATTGATATATCA---ATCTTCTCTTTACATATAGCAGGAATATCATCAATTCTTGGAGCAATCAATTTTATTTCAACCATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCTCTAATAGTTTGATCAATTATAATTACAGCGGTACTTCTTCTTCTTTCACTCCCAGTTTTAGCTGGA---GCTATTACCATACTTCTTACAGATCGAAATTTAAATACATCATTCTTTGATCCCTCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCAGAAGTATATATTTTAATCTTACCAGGATTCGGTTTAATTTCTCATATTATTATAAGAGAAAGAGGAAAAAAA---GAAACTTTTGGCTCACTTGGAATAATCTATGCTATAATTGCAATTGGATTTTTAGGATTTATCGTCTGAGCACATCATATATTTACAATTGGACTAGATGTAGATACCCGAGCCTATTTTACTTCAGCAACTATAATTATTGCTATTCCTACAGGCATTAAAATTTTTAGATGAATTTCT---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 6 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 2 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCATCTATAAGTATAATTATTCGTTTAGAACTCGGATCTTGTAATTCACTAATTAATAAT---GATCAAATTTATAATACTATTGTAACAAGTCACGCTTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAACTTTCTAATTCCTTTAATA---TTAGGGTCACCTGATATAGCGTACCCTCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCAATTACATTATTAATAATAAGAAATTTTTTAAGAAATGGAGTTGGAACAGGATGAACTATTTATCCCCCTCTTGCATCTAATATTTTTCACAGTGGTCCTTCAATTGATATATCA---ATTTTTTCTCTTCATATAGCTGGAATATCATCAATTTTAGGAGCTATTAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCCTTAGATAAAATTCCTTTAATAGTTTGATCAATTTTAATTACTGCTATTCTTCTTCTTCTTTCTCTCCCAGTACTTGCAGGA---GCAATTACTATATTATTAACAGACCGTAACTTAAATACTTCCTTTTTTGATCCGTCAGGAGGAGGAGACCCAATTTTATACCAACATCTATTTTGATTTTTTGGACATCCAGAAGTTTATATTCTAATTTTACCGGGATTTGGATTAATTTCTCATATTATTATAAATGAGAGAGGTAAAAAA---GAAACATTTGGCTCTCTTGGAATAATTTATGCTATAATTGCTATTGGATTTCTAGGTTTTATTGTATGAGCTCATCATATATTTACAATTGGGTTAGATGTTGATACACGAGCTTATTTTACTTCCGCAACTATAATTATTGCTATCCCTACAGGTATTAAAATTTTTAGATGAATTTCA---ACTTTACATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 2 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 5 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATGATTATTCGTTTAGAATTGGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCCTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATCGGAGGATTTGGAAACTTTTTAGTTCCTTTAATA---CTAGGATCCCCAGATATAGCCTATCCCCGTATAAATAATATAAGATTCTGACTCCTCCCTCCCTCAATTATATTACTAATATTAAGAAATTTCTTAAGTAATGGAGTTGGAACAGGTTGAACAATTTATCCCCCATTAGCTTCTAATATTTTTCACAGAGGCCCTTCAGTTGATATATCT---ATCTTCTCTCTACATTTAGCAGGAATATCTTCAATTCTTGGAGCAATTAATTTTATTTCAACAATTATTAATATACATCACAAATCAATTTCTATAGATAAAACTCCGCTAATAGTATGATCAATTATAATTACAGCTGTACTTCTCCTCCTTTCACTTCCAGTTTTAGCGGGA---GCAATTACTATACTTCTAACAGATCGAAATTTAAATACATCATTTTTTGATCCCTCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGTCATCCAGAAGTATATATCTTAATCTTACCAGGATTTGGTCTTATTTCTCATATTATTATAAGGGAAAGAGGAAAAAAA---GAAACTTTTGGTTCTCTTGGAATAATTTATGCTATAATTGCAATTGGATTTCTAGGATTTATTGTTTGAGCACATCACATATTTACAATTGGGCTAGATGTAGATACTCGCGCTTATTTTACATCAGCAACTATAATTATCGCAATTCCTACAGGCATTAAAATTTTTAGGTGAATTTCT---ACCCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 5 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 4 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATGATTATTCGTTTAGAATTGGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCCTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATCGGAGGATTTGGAAACTTTTTAGTTCCCTTAATA---CTAGGATCCCCTGATATAGCCTATCCTCGTATAAATAATATAAGATTCTGACTCCTCCCTCCCTCAATTATATTACTAATATTAAGAAATTTCTTAAGTAATGGAGTTGGAACAGGCTGAACAATTTATCCCCCATTAGCTTCTAATATTTTTCACAGAGGCCCTTCAGTTGATATATCT---ATCTTCTCTCTACATTTAGCAGGAATATCTTCAATTCTTGGAGCAATTAATTTTATTTCAACAATTATTAATATACATCACAAATCAATTTCTATAGATAAAACTCCACTAATAGTATGATCAATTATAATTACAGCTGTACTTCTCCTCCTTTCACTTCCAGTTTTAGCCGGA---GCAATTACTATACTTCTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGTCATCCAGAAGTATATATCTTAATCTTACCAGGATTTGGTCTTATTTCTCATATTATTATAAGGGAAAGAGGAAAAAAA---GAAACTTTTGGTTCTCTTGGAATAATTTATGCTATAATTGCAATTGGATTTCTAGGATTTATTGTTTGAGCACATCACATATTTACAATTGGACTAGATGTAGATACTCGCGCTTATTTTACATCAGCAACTATAATTATTGCAATTCCTACAGGCATTAAAATTTTTAGATGAATTTCT---ACCCTCCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 4 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. 3 GJ-2010

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATAATTATTCGTTTAGAATTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACTTTAGTAACTAGCCATGCATTTATTATAATTTTTTTTATAGTTATACCTTTCATAATTGGAGGCTTTGGAAATTTTTTAGTTCCCTTAATG---CTGGGATCACCTGATATAGCCTATCCTCGTATAAATAATATAAGATTTTGGCTACTTCCCCCATCAATTATATTATTAATATTAAGAAATTTTTTAAGGAATGGTGTAGGGACAGGGTGAACAATTTATCCCCCATTAGCTTCTAATATTTTTCATAGAGGCCCTTCATTTGATATATCA---ATCTTTTCCTTACATATGGCAGGAATATCTTCAATTCTTGGGGCAATCAATTTTATTTCAACAATTATTAATATACACCATAAAGCAATTTCAATGGATAAAACACCTCTAATAGTATGATCAATTATAATCACAGCTATTCTTCTTCTTTTATCCCTTCCTGTTTTAGCAGGA---GCGATTACTATATTACTCACAGATCGAAATTTAAATACCTCATTTTTTGATCCTTCAGGCGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACATCCTGAGGTCTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCATATTATTATAAATGAAAGAGGTAAAAAA---GAAACTTTTGGATCTCTTGGTATAATTTACGCTATAATTGCAATTGGATTTTTAGGATTTATTGTCTGAGCTCATCATATATTTACTATTGGTTTAGATGTAGATACTCGAGCTTATTTTACTTCAGCAACTATGATTATTGCCATTCCCACAGGTATTAAAATTTTTAGTTGAATTTCT---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. 3 GJ-2010

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M273

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATAATTATCCGGCTAGAACTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTYATAGTTATACCTTTTATAATTGGAGGATTTGGGAATTTTTTAGTTCCCTTAATA---TTAGGATCTCCTGATATAGCCTACCCTCGTATAAATAATATAAGATTTTGACTTCTCCCTCCTTCAATYATATTACTAATATTAAGAAATTTCTTAAGGAATGGAGTTGGAACCGGTTGAACAATTTACCCCCCACTTGCTTCTAATATTTTTCACAGAGGTCCCTCAGTTGATATATCT---ATCTTCTCTCTACATATAGCAGGAATATCTTCAATTCTAGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCCCTAATAGTATGATCAATTATAATTACTGCAGTACTTCTTCTCCTTTCCTTACCAGTCCTAGCAGGA---GCTATTACCATACTTCTCACAGATCGCAATCTAAATACTTCATTTTTTGATCCCTCAGGAGGCGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTCTATATTTTAATCCTGCCAGGATTCGGCCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACTTTTGGCTCACTAGGAATAATTTATGCTATAATTGCAATTGGTTTCTTAGGATTTATTGTTTGAGCACATCATATATTTACAATTGGGTTAGATGTAGATACTCGTGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCCACAGGTATTAAAATTTTTAGATGAATTTCC---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M273

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M275

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATGATTATTCGTTTAGAATTGGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCCTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATCGGAGGATTTGGAAACTTTTTAGTTCCTTTAATA---CTAGGATCCCCAGATATAGCCTATCCCCGTATAAATAATATAAGATTCTGACTCCTCCCTCCCTCAATTATATTACTAATATTAAGAAATTTCTTAAGTAATGGAGTTGGAACAGGTTGAACAATTTATCCCCCATTAGCTTCTAATATTTTTCACAGAGGCCCTTCAGTTGATATATCT---ATCTTCTCTCTACATTTAGCAGGAATATCTTCAATTCTTGGAGCAATTAATTTTATTTCAACAATTATTAATATACATCACAAATCAATTTCTATAGATAAAACTCCGCTAATAGTATGATCAATTATAATTACAGCTGTACTTCTCCTCCTTTCACTTCCAGTTTTAGCGGGA---GCAATTACTATACTTCTAACAGATCGAAATTTAAATACATCATTTTTTGATCCCTCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTTTGATTTTTTGGTCATCCAGAAGTATATATCTTAATCTTACCAGGATTTGGTCTTATTTCTCATATTATTATAAGGGAAAGAGGAAAAAAA---GAAACTTTTGGTTCTCTTGGAATAATTTATGCTATAATTGCAATTGGATTTCTAGGATTTATTGTTTGAGCACATCACATATTTACAATTGGGCTAGATGTAGATACTCGCGCTTATTTTACATCAGCAACTATAATTATCGCAATTCCTACAGGCATTAAAATTTTTAGGTGAATTTCT---ACCCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M275

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M295

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCAATAAGAATAATTATCCGGCTAGAACTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTCCCATTAATA---TTAGGATCTCCTGATATAGCCTACCCTCGTATAAATAATATAAGATTTTGACTTCTCCCTCCTTCAATTATATTACTAATATTAAGAAATTTCCTAAGAAACGGAGTTGGAACCGGTTGAACAATTTACCCCCCACTTGCTTCTAATATTTTTCACAGAGGTCCCTCAGTTGATATATCT---ATCTTCTCTCTACATATAGCAGGAATGTCTTCAATTCTTGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCCCTAATAGTATGATCAATTATAATTACTGCTGTACTTCTTCTCCTTTCCTTACCAGTCCTAGCAGGA---GCTATTACCATACTTCTCACAGATCGTAACCTAAATACTTCATTTTTTGATCCCTCGGGAGGCGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTCTATATTTTAATCCTACCAGGATTCGGCCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTAGGAATAATTTATGCCATAATTGCAATTGGTTTCTTAGGATTTATTGTTTGAGCACATCATATATTTACAATTGGATTAGATGTAGATACTCGTGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCCACAGGTATTAAAATTTTTAGATGAATTTCT---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M295

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M300

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCCTCAATAAGAATAATTATTCGTCTAGAATTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTCATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCATTAATA---TTAGGATCTCCTGATATGGCCTATCCACGTATAAATAATATAAGATTCTGACTCCTTCCTCCTTCAATCATATTACTAATATTAAGAAATTTCCTAAGGAATGGAGTGGGAACTGGTTGAACAATTTATCCCCCATTAGCTTCTAATATTTTCCATAGAGGCCCTTCAATTGATATATCA---ATCTTCTCCCTACATATAGCAGGAATGTCCTCAATTCTCGGAGCAATCAATTTTATTTCAACAATTATTAATATACACCATAAATCAGTTTCTATAGATAAAACTCCTCTAATAGTGTGGTCAATTATAATTACAGCAGTACTTCTCCTTCTTTCCCTCCCAGTTTTAGCAGGA---GCTATTACCATGCTTCTCACAGATCGAAATTTAAATACATCATTTTTTGACCCTTCAGGGGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTATATATTTTAATTTTACCAGGATTTGGCTTAATTTCTCATATTATTATAAGAGAAAGAGGAAAAAAA---GAAACTTTTGGCTCACTTGGAATAATTTATGCTATAATTGCAATCGGATTTTTAGGATTTATTGTCTGAGCACATCATATATTTACAATTGGACTGGATGTAGATACCCGAGCTTATTTTACTTCAGCTACTATAATTATTGCTATTCCCACAGGCATTAAAATTTTTAGATGAATTTCT---ACCCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M300

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M302

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCCTCAATAAGAATAATTATTCGACTAGAACTAGGATCTTGTAATTCATTGATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTCATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCCTTAATA---TTAGGATCTCCTGATATAGCTTACCCTCGTATAAATAACATAAGATTTTGACTCCTCCCTCCTTCAATTATATTACTAATATTAAGAAATTTCCTAAGGAACGGTGTTGGAACCGGTTGAACGATTTACCCCCCACTTGCCTCTAATATTTTTCACAGAGGTCCCTCAATTGATATATCT---ATCTTCTCTCTACATATAGCAGGAATGTCTTCAATTCTTGGGGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCCCTAATAGTATGATCAATTATAATTACTGCAGTACTTCTTCTACTTTCCTTACCAGTCTTAGCAGGA---GCGATTACCATACTTCTTACTGATCGTAACCTAAATACTTCATTTTTTGATCCCTCAGGGGGAGGAGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCAGAAGTCTATATTTTAATTCTACCAGGATTTGGCCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTAGGAATAATTTATGCTATAATTGCAATTGGTTTCTTAGGATTTATTGTTTGAGCACATCATATATTTACAATTGGATTAGATGTAGATACTCGTGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCCACAGGTATTAAAATTTTTAGATGAATTTCT---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M302

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M316

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCCTCAATAAGAATAATTATTCGTCTAGAATTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTAATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCATTAATA---TTAGGATCTCCTGATATGGCCTACCCACGTATAAATAATATAAGATTCTGACTCCTTCCTCCTTCAATCATATTACTAATATTAAGAAATTTCCTAAGGAATGGAGTAGGAACTGGTTGAACAATTTATCCTCCATTAGCTTCTAATATCTTCCATAGAGGTCCCTCAATTGATATATCA---ATCTTTTCCCTACATATGGCAGGAATGTCCTCAATTCTCGGAGCAATCAATTTTATTTCAACAATTATTAATATGCACCATAAATCAATTTCTATAGATAAAACTCCTCTAATAGTATGATCAATTATAATTACAGCAGTACTTCTCCTTCTTTCTCTCCCAGTTTTAGCAGGA---GCTATTACCATACTTCTCACTGATCGAAATTTAAATACATCATTTTTTGACCCCTCCGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGCCATCCAGAAGTCTATATTTTAATCCTACCAGGATTCGGCCTAATTTCTCATATTATTATAAATGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTAGGAATAATTTATGCTATAATTGCAATTGGTTTTTTAGGATTTATTGTTTGAGCACATCATATATTTACAATTGGATTAGATGTAGATACTCGTGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCCACAGGTATTAAAATTTTTAGATGAATTTCT---ACTCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M316

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M350

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCCTCAATAAGAATAATTATTCGCCTAGAATTAGGATCTTGTAATTCACTAATTAATAAT---GACCAAATTTATAACACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTCATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAATTCCCTTAATA---TTAGGATCTCCTGATATAGCATATCCTCGTATAAATAATATAAGATTTTGACTCCTCCCTCCCTCAATCATATTACTAATATTAAGAAATTTCCTAAGGAATGGTGTAGGAACTGGCTGAACAATTTATCCTCCATTAGCTTCTAATATTTTTCATAGGGGCCCCTCAATTGATATATCA---ATCTTCTCTCTACATATAGCAGGAATGTCTTCAATTCTCGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCTCTAATAGTATGATCAATTATAATTACAGCAGTACTTCTCCTCCTTTCCCTTCCAGTTTTAGCAGGA---GCAATTACCATGCTTCTCACAGATCGAAATTTAAATACATCATTTTTTGACCCCTCAGGAGGGGGAGACCCAATTTTATATCAACATTTATTTTGATTCTTTGGCCATCCAGAAGTCTATATTTTAATCCTACCAGGATTCGGYCTAATTTCTCATATTATTATAAGAGAAAGAGGAAAAAAA---GAAACTTTTGGATCACTWGGAATAATTTATGCTATAATTGCAATTGGWTTTTTAGGATTTATTGTCTGAGCACATCATATATTTACAATTGGACTAGATGTAGATACCCGAGCTTATTTTACATCAGCAACTATAATTATTGCTATTCCCACAGGCATTAAAATTTTTAGATGAATTTCT---ACCCTTCATGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M350

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica n. sp. M365

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTTCTATGAGTATGATTATTCGCTTAGAATTAGGGTCTTGTAATCCCCTAATTAATAAT---GATCAAGTTTATAATACTCTAGTAACTAGTCACGCATTTATTATAATTTTTTTCATAGTAATACCTTTTATAATTGGAGGATTCGGAAATTTTTTAATTCCTTTAATA---TTAGGATCTCCTGACATAGCTTACCCCCGAATAAATAATATAAGATTTTGACTCCTCCCCCCCTCAATTATATTATTAATATTAAGAAACTTTCTAAGAAACGGAGTAGGGACAGGATGAACAATTTATCCGCCCTTAGCCTCCAATATCTTCCACAGTGGGCCCTCAGTTGATATATCA---ATTTTCTCTCTTCATATAGCCGGAATGTCTTCAATTTTAGGAGCTATTAATTTTATTTCTACAATTATTAATATACACCATAAATCAGTTTCTATAGATAAAACTCCCCTAATAGTTTGATCAATTTTAATTACTGCTGTATTACTCCTTCTATCACTCCCAGTATTAGCAGGG---GCCATTACCATACTACTAACAGACCGAAATCTGAATACTTCTTTTTTTGATCCCTCTGGAGGCGGAGATCCTATTTTATATCAACATTTATTCTGATTCTTTGGACACCCTGAAGTTTATATTCTAATCTTACCAGGTTTTGGCCTAATTTCTCATATTATTATAAATGAAAGTGGGAAAAAA---GAAACATTTGGTTCTCTAGGAATAATTTATGCCATAATTGCTATTGGATTCCTGGGATTCATTGTTTGGGCTCATCATATATTTACTATTGGTTTAGATGTAGATACTCGAGCATACTTCACCTCTGCAACTATAATTATCGCAATCCCTACTGGTATTAAAATTTTCAGATGAATTTCA---ACACTACACGGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica n. sp. M365

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica cf. fracticornis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica cf. nearctica GJ-2008

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATTTTTGCTATTTGAGCAGGTATGATTGGCTCTTCAATA---AGAATAATTATCCGGCTAGAACTAGGATCTTGTAATTCATTAATTAATAAT---GATCAAATTTATAATACCTTAGTTACTAGTCATGCATTTATTATAATTTTCTTTATAGTTATACCTTTTATAATTGGAGGATTTGGGAATTTTTTAGTTCCCTTAATA---TTAGGATCTCCTGATATAGCCTACCCTCGTATAAATAATATAAGATTTTGACTTCTCCCTCCTTCAATTATATTATTAATATTAAGAAATTTCTTAAGGAATGGAGTTGGAACCGGTTGAACAATTTACCCCCCACTTGCTTCTAATATTTTTCACAGAGGCCCCTCAGTTGATATATCT---ATCTTCTCTCTACATATAGCAGGAATATCTTCAATTCTAGGAGCAATCAATTTTATTTCAACAATTATTAATATACATCATAAATCAATTTCTATAGATAAAACTCCCCTAATAGTATGATCAATTATAATTACTGCAGTACTTCTTCTCCTTTCCTTACCAGTCCTAGCAGGA---GCTATTACCATACTTCTCACAGATCGCAATCTAAATACTTCATTTTTTGATCCCTCAGGAGGCGGAGACCCAATTTTATATCAACAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica cf. nearctica GJ-2008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Myrmica cf. fracticornis GJ-2008

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATTTTTGCTATTTGAGCCGGTATAATTGGTTCTTCAATA---AGAATAATTATTCGTTTAGAATTAGGATCTTGTAATTCATTAATTAATAAT---GACCAAATTTATAATACCTTAGTCACTAGACATGCATTTATTATAATTTTCTTCATAGTTATACCTTTTATAATTGGAGGATTTGGAAATTTTTTAGTTCCCTTAATA---CTGGGTTCTCCCGATATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTCCTTCCTCCCTCAATCATATTATTAATATTAAGAAACTTCTTAAGGAATGGAGTAGGAACTGGGTGAACAATTTACCCCCCATTAGCTTCTAATATTTTTCACAGGGGCCCCTCAGTCGATATATCA---ATCTTCTCTTTACATATAGCAGGAATGTCCTCAATTCTTGGAGCAATTAATTTTATTTCAACAATTATTAATATACATCACAAATCAATTTCTATAGATAAAACTCCTTTAATAGTATGATCAATTATAATTACAGCAGTACTTTTACTTCTTTCCCTTCCAGTCTTAGCTGGA---GCAATTACCATACTTCTTACAGATCGAAATTTAAATACATCATTTTTCGATCCCTCAGGAGGGGGAGACCCAATTTTATATCAACAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica cf. fracticornis GJ-2008

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Myrmica cf. striolagaster

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Myrmica

Myrmica is a genus of ants within the subfamily Myrmicinae. It is widespread throughout the temperate regions of the Holarctic and high mountains in Southeast Asia. The genus consists of around 200 known species, and additional subspecies, although this figure is likely only to rise as soon as Chinese and Neartic fauna lists are revised. The genus contains a number of inquiline species (commensal symbionts), other Myrmica species that manage to invade the nest of their host. Subsequently, they use hormones to manipulate the host colony in such a way that eggs of the host queen develop into workers, and parasite brood into sexuals. Hence, the parasite is not able to sustain a colony of its own, but uses host resources instead. This parasitism is employed primarily by Phengaris butterflies with specific species such as Phengaris arion forming predatory relationships.[2]

Similarly, larvae of the butterfly genus Maculinea (Lepidoptera, family Lycaenidae) live inside Myrmica nests where they are either directly fed by ants or prey upon ant brood. The five European large blue butterfly species are facing extinction and are subject to large conservation efforts.

Species[edit]

Myrmica sp. from Germany

References[edit]

  1. ^ "Genus: Myrmica". antweb.org. AntWeb. Retrieved 13 October 2013. 
  2. ^ Sielezniew, Marcin; Dario Patricelli, Izabela Dziekańska, Francesca Barbero, Simona Bonelli, Luca Pietro Casacci , Magdalena Witek & Emilio Balletto (2010). "The First Record of Myrmica lonae (Hymenoptera: Formicidae) as a Host of the Socially Parasitic Large Blue Butterfly Phengaris (Maculinea)* arion(Lepidoptera: Lycaenidae)". Sociobiology 56: 465–475. 
  3. ^ Syn: M. baikalensis Karav., 1931
  4. ^ a b Link text, additional text.
  5. ^ Syn: M. sifolina
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!