Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Ophion flavidusDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Ophion flavidusDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTCTTTATTTTATTTTCGGAATATGATCTGGAATAATAGGATCTTCATTAAGATTATTAATTCGAATAGAATTAGGTAATCCTGGATATTTAATTAATAATGATCAACTTTATAACTCTATTATTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGATTCGGAAATTGAATAATTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTATTAATCTTCTAATTTTAAGAAATATAACTAATCAAGGAGTAGGTACAGGATGAACAGTTTATCCTCCACTTTCATTAAATTTGAATCATGAAGGAATAGCATTAGATATAGCTATTTTTTCTCTTCATATTGCAGGTCTATCTTCAATTATAGGTGCAATCAATTTTATTACAACAATTATAAATATAAAAAATTTAAATATAAATTTTGAACAAATTACTTTATTTTCATGATCTATATTAATTACAACAATCTTATTATTATTAGCAGTCCCAGTATTAGCAGGAGCAATTACCATACTTTTAACTGACCGTAATCTAAATACAACTTTTTTTGACCCATCAGGAGGTGGTGACCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophion flavidusDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ophion Janzen03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:238Public Records:17
Specimens with Sequences:206Public Species:3
Specimens with Barcodes:193Public BINs:6
Species:10         
Species With Barcodes:9         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Ophion

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!