Molecular Biology and Genetics
Molecular Biology
Statistics of barcoding coverage: Ophion flavidusDHJ02
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Ophion flavidusDHJ01
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AATTCTTTATTTTATTTTCGGAATATGATCTGGAATAATAGGATCTTCATTAAGATTATTAATTCGAATAGAATTAGGTAATCCTGGATATTTAATTAATAATGATCAACTTTATAACTCTATTATTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGATTCGGAAATTGAATAATTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTATTAATCTTCTAATTTTAAGAAATATAACTAATCAAGGAGTAGGTACAGGATGAACAGTTTATCCTCCACTTTCATTAAATTTGAATCATGAAGGAATAGCATTAGATATAGCTATTTTTTCTCTTCATATTGCAGGTCTATCTTCAATTATAGGTGCAATCAATTTTATTACAACAATTATAAATATAAAAAATTTAAATATAAATTTTGAACAAATTACTTTATTTTCATGATCTATATTAATTACAACAATCTTATTATTATTAGCAGTCCCAGTATTAGCAGGAGCAATTACCATACTTTTAACTGACCGTAATCTAAATACAACTTTTTTTGACCCATCAGGAGGTGGTGACCCAATTTTATACCAACATTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Ophion flavidusDHJ01
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Ophion Janzen03
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 238 | Public Records: | 17 |
| Specimens with Sequences: | 206 | Public Species: | 3 |
| Specimens with Barcodes: | 193 | Public BINs: | 6 |
| Species: | 10 | ||
| Species With Barcodes: | 9 | ||
© Barcode of Life Data Systems
Trusted
Barcode data
© Barcode of Life Data Systems
Trusted
Locations of barcode samples
Collection Sites: world map showing specimen collection locations for Ophion
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
