Overview

Comprehensive Description

Taxonomic History

Anochetus goodmani Fisher & Smith, 2008 PDF: 6, figs. 2e-h (w.q.) MADAGASCAR. AntCat AntWiki
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Taxonomic Treatment

Fisher, B. L., 2008:
  urn:lsid:zoobank.org:act:C7D27B95-E1F0-41AC-968C- 76BCF3886010
  Figures: worker 2e,f; queen 2g,h; map 6a
  Worker measurements: maximum and minimum based on all specimens, n= 15, (holotype): HL 1.77-2.01 (1.92), HW 1.55- 1.81 (1.77), CI 86-92 (92), EL 0.35-0.43 (0.42), ML 1.04-1.15 (1.11), MI 56-66 (58), SL 1.68-1.97 (1.79) SI 101-109 (101), WL 2.52-2.89 (2.66), FL 1.85-2.17 (2.03), PW 0.92-1.06 (1.01).
  Queen (ergatoid) measurements: maximum and minimum based on n = 5. HL 1.62-1.79, HW 1.49-1.65, CI 91-93, EL 0.37-0.41, ML 0.92-1.02, MI 55-59, SL 1.56-1.71, SI 99- 106, WL 2.33-2.55, FL 1.77-1.91, PW 0.88-0.99.
  Worker Diagnosis: Blade of mandible with five teeth and denticles located at the distal halfofthe blade length. Petiole dorsal margin without spines. In front view, the dorsal petiolar margin flat with lateral margin rounded (Fig. 6b). Pilosity, sculpture as in Figures 2e,f.
  The species is most similar to A. boltoni but can be easily distinguished by its petiole node without apical spines.
 No winged queens are known. Ergatoid queens were collected at six localities. In four of the collections, three ergatoid queens were collected in the same locality. They are very similar in size and shape to workers (Figs 2g,h), and have no ocelli (Fig. 2g). Males are not known.
  Distribution and biology. A. goodmani is endemic to Madagascar and is widespread in northern and western parts of the island. It has been collected in dry forest and rainforest as low as 30 m in altitude and also in montane rainforest at the altitude 960 m on Montagne d'Ambre (Fig. 6a), most frequently under stones (12 collections) and sifted litter (7), but also at light (1), beating low vegetation (3), rot pocket (1), in rotten log (6), ground foragers (1), ground nest (9), Malaise trap (1), on low vegetation (1), and pitfall traps (4).
  CO1. Average iIntraspecific sequence divergence of 6.37%. There is strong geographic coherence in the divergence patterns (Figs 9, 15, Table 2) with deep divergences occurring between separate regions isolated by habitat and mountains.
  Diagnostic barcoding loci. A. goodmani : Y-231 ( madagascarensis and grandidieri A; boltoni and pattersoni T), W-233 (all others A), RWR-368-370 (others are all ATG), Y-541 (others are all T), R-543 (others are all A), W-546 (others are all T), W-585 (others are all T), M-634 (others are all C). RWCW-42-45 & WTTAG-66-70 (this distinguishes goodmani from all (including boltoni ) except some madagascarensis ), & GT-83-84 ( madagascarensis is TA).
  Discussion. Anochetus goodmani is characterized by extreme divergence within the barcode region. To date, sequencing complementary nuclear markers has provided some degree of support for the deepest CO1 divergences (between the north and south-west of Madagascar) as being separate species. Importantly however, ITS1 sequences as divergent have been produced from the same individual (Appendix S1 and Table 3). Although CO1 supports more than one operational unit within A. goodmani the hypothesis of cryptic species in relatively isolated environments requires further evidence with less ambiguity.
  Additional material examined for Anochetus goodmani : In addition to the type material, specimens from 56additional collecting events from the following 18 localities were examined in this study.MADAGASCAR : Province Antsiranana : Montagne des Francais , 7.2 km 142° SE Antsiranana ;Parc National Montagne d'Ambre ;Reserve Speciale de l'Ankarana , 13.6 km 192° SSW Anivorano Nord ;Reserve Speciale de l'Ankarana , 22.9 km 224° SW Anivorano Nord ;Foret d'Ampondrabe, 26.3 km 10° NNE Daraina ;Foret d' Andavakoera , 21.4 km 75° ENE Ambilobe ; 4.6 km 356° NBetsiaka ;Foret d' Antsahabe , 11.4 km 275° WDaraina ;Foret de Binara , 7.5 km 230° SW Daraina ;Ampasindava, Foret d'Ambilanivy , 3.9 km 181° SAmbaliha ;Foret d'Anabohazo , 21.6 km 247° WSW Maromandia ;Reserve Speciale de Bemarivo , 23.8 km 223° SW Besalampy ;Parc National Tsingy de Bemaraha , 10.6 km ESE 123° Antsalova ;Parc National Tsingy de Bemaraha , 2.5 km 62 ° ENE Bekopaka , Ankidrodroa River ;Parc National Tsingy de Bemaraha , 3.4 km 93° EBekopaka , Tombeau Vazimba .Province Toliara : Parc National de Kirindy Mite , 16.3 km 127° SE Belo sur Mer .
  Figure 8. Anochetus males, terminalia, lateral view. A, boltoni CASENT0063847. B, grandidieri CASENT0080660. B, madagascarensis CASENT0063421. D, pattersoni CASENT0172617. doi:10.1371/journal.pone.0001787.g008
 
Creative Commons Attribution Non Commercial Share Alike 1.0 (CC BY-NC-SA 1.0)

 

Source: AntWeb

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

urn:lsid:zoobank.org:act:C7D27B95-E1F0-41AC-968C- 76BCF3886010

 

Figures: worker 2e,f; queen 2g,h; map 6a

 

Worker measurements: maximum and minimum based on all specimens, n= 15, (holotype): HL 1.77-2.01 (1.92), HW 1.55- 1.81 (1.77), CI 86-92 (92), EL 0.35-0.43 (0.42), ML 1.04-1.15 (1.11), MI 56-66 (58), SL 1.68-1.97 (1.79) SI 101-109 (101), WL 2.52-2.89 (2.66), FL 1.85-2.17 (2.03), PW 0.92-1.06 (1.01).

 

Queen (ergatoid) measurements: maximum and minimum based on n = 5. HL 1.62-1.79, HW 1.49-1.65, CI 91-93, EL 0.37-0.41, ML 0.92-1.02, MI 55-59, SL 1.56-1.71, SI 99- 106, WL 2.33-2.55, FL 1.77-1.91, PW 0.88-0.99.

 

Worker Diagnosis: Blade of mandible with five teeth and denticles located at the distal halfofthe blade length. Petiole dorsal margin without spines. In front view, the dorsal petiolar margin flat with lateral margin rounded (Fig. 6b). Pilosity, sculpture as in Figures 2e,f.

 

The species is most similar to A. boltoni but can be easily distinguished by its petiole node without apical spines.

 

No winged queens are known. Ergatoid queens were collected at six localities. In four of the collections, three ergatoid queens were collected in the same locality. They are very similar in size and shape to workers (Figs 2g,h), and have no ocelli (Fig. 2g). Males are not known.

 

Distribution and biology. A. goodmani is endemic to Madagascar and is widespread in northern and western parts of the island. It has been collected in dry forest and rainforest as low as 30 m in altitude and also in montane rainforest at the altitude 960 m on Montagne d'Ambre (Fig. 6a), most frequently under stones (12 collections) and sifted litter (7), but also at light (1), beating low vegetation (3), rot pocket (1), in rotten log (6), ground foragers (1), ground nest (9), Malaise trap (1), on low vegetation (1), and pitfall traps (4).

 

CO1. Average iIntraspecific sequence divergence of 6.37%. There is strong geographic coherence in the divergence patterns (Figs 9, 15, Table 2) with deep divergences occurring between separate regions isolated by habitat and mountains.

 

Diagnostic barcoding loci. A. goodmani : Y-231 ( madagascarensis and grandidieri A; boltoni and pattersoni T), W-233 (all others A), RWR-368-370 (others are all ATG), Y-541 (others are all T), R-543 (others are all A), W-546 (others are all T), W-585 (others are all T), M-634 (others are all C). RWCW-42-45 & WTTAG-66-70 (this distinguishes goodmani from all (including boltoni ) except some madagascarensis ), & GT-83-84 ( madagascarensis is TA).

 

Discussion. Anochetus goodmani is characterized by extreme divergence within the barcode region. To date, sequencing complementary nuclear markers has provided some degree of support for the deepest CO1 divergences (between the north and south-west of Madagascar) as being separate species. Importantly however, ITS1 sequences as divergent have been produced from the same individual (Appendix S1 and Table 3). Although CO1 supports more than one operational unit within A. goodmani the hypothesis of cryptic species in relatively isolated environments requires further evidence with less ambiguity.

 

Additional material examined for Anochetus goodmani : In addition to the type material, specimens from 56additional collecting events from the following 18 localities were examined in this study.MADAGASCAR : Province Antsiranana : Montagne des Francais , 7.2 km 142° SE Antsiranana ;Parc National Montagne d'Ambre ;Reserve Speciale de l'Ankarana , 13.6 km 192° SSW Anivorano Nord ;Reserve Speciale de l'Ankarana , 22.9 km 224° SW Anivorano Nord ;Foret d'Ampondrabe, 26.3 km 10° NNE Daraina ;Foret d' Andavakoera , 21.4 km 75° ENE Ambilobe ; 4.6 km 356° NBetsiaka ;Foret d' Antsahabe , 11.4 km 275° WDaraina ;Foret de Binara , 7.5 km 230° SW Daraina ;Ampasindava, Foret d'Ambilanivy , 3.9 km 181° SAmbaliha ;Foret d'Anabohazo , 21.6 km 247° WSW Maromandia ;Reserve Speciale de Bemarivo , 23.8 km 223° SW Besalampy ;Parc National Tsingy de Bemaraha , 10.6 km ESE 123° Antsalova ;Parc National Tsingy de Bemaraha , 2.5 km 62 ° ENE Bekopaka , Ankidrodroa River ;Parc National Tsingy de Bemaraha , 3.4 km 93° EBekopaka , Tombeau Vazimba .Province Toliara : Parc National de Kirindy Mite , 16.3 km 127° SE Belo sur Mer .

 

Figure 8. Anochetus males, terminalia, lateral view. A, boltoni CASENT0063847. B, grandidieri CASENT0080660. B, madagascarensis CASENT0063421. D, pattersoni CASENT0172617. doi:10.1371/journal.pone.0001787.g008

License not applicable

Fisher, B. L.

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anochetus goodmani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGCTATTTGATCGGGAATAATTGGGTCATCAATAAGAATATTAATTCGATTAGAATTAGGAACATGTAATTCTTTAATTATAAACGATCAAATTTATAATTCATTAATTACAAGACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTTATGATTGGAGGATTTGGAAATTATTTAGTTCCATTAATATTAGGTTCACCTGATATAGCTTATCCTCGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCTTTAATTTTATTATTATCAAGAAGTTTTGTTTATAACGGAGTAGGAACAGGATGAACAGTGTATCCTCCTTTATCAAATAATATATTTCATAATGGATTTTCTACAGATTTAGCAATTTTTTCTTTACATATTGCAGGAATATCTTCTATTATAGGATCAATTAATTTTATTTCAACAATTTTAAATATACATCATAAAAATTTATCTTTAGATAAAATTTCATTATTGGTATGATCAATTTTAATTACAGCAATTTTACTTTTATTATCATTACCTGTATTAGCTGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCATCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anochetus goodmani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 45
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Anochetus goodmani

Anochetus goodmani has been discovered and described by Fisher, B. L. & Smith, M. A. in 2008.[1]

References

  1. ^ Fisher, B. L. & Smith, M. A., 2008, A revision of Malagasy species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae)., PlosOne (3), pp. 1-23: 6-8


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!