Molecular Biology and Genetics

Molecular Biology

Barcode data: Megalopyge opercularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATATTAGGAACATCTCTAAGAATGTTAATTCGAACTGAACTTGGAAATCCGAGATCCTTAATTGGAGACGACCAAATTTATAACACTATTGTTACAGCTCATGCATTCATTATAATTTTCTTTATAGTTATACCAATCATAATTAGCGGATTTGGAAACTGATTAGTACCCTTAATATTAGGAGCACCAGATATAGCTTTTCCACGTATAAATAATCTTAGATTTTGATTATTACCCCNATCTATTATACTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTACCCCCCCCTTTCATCTAATATTGCCCACAGAGGTAGATCAGTAGATTTAACAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGTGCTATTAATTTTATTACCACTATTATTAATATACGACCTAATAATATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTTAGAATTACTGCTCTCCTTTTATTATTATCATTACCAGTTTTAGCCGGAGCTATTACTATACTTTTAACTGACCGAAATTTAAATACTTCCTTTTTTGACCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Megalopyge opercularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Megalopyge opercularis

The moth Megalopyge opercularis has numerous common names, including southern flannel moth for its adult form, and puss moth, puss caterpillar, tree asp, and the asp caterpillar for its larval form.

Description[edit]

M. opercularis is visually striking in both larval and adult forms.

Larva[edit]

The inch-long larva is generously coated in long, luxuriant hair-like setae, making it resemble a tiny Persian cat, the characteristic that presumably gave it the name "puss." It is variable in color, from downy grayish-white to golden-brown to dark charcoal gray. It often has a streak of bright orange running longitudinally. The 'fur' on early-stage larvae is sometimes extremely curly, giving the larva a cottony, puffed-up look. The body tapers to a tail that extends well beyond the body, unlike its relative M. crispata.[1] The middle instar has a more dishevelled, 'bad-hair-day' appearance, without a distinctive tail.

The 'fur' of the larva contains venomous spines that cause extremely painful reactions in human skin upon contact. The reactions are sometimes localized to the affected area but are often very severe, radiating up a limb and causing burning, swelling, nausea, headache, abdominal distress, rashes, blisters, and sometimes chest pain, numbness, or difficulty breathing.[2] Additionally, it is not unusual to find sweating from the welts or hives at the site of the sting. Ironically, the resemblance of the larvae to soft, colorful cotton balls encourages people to pick them up and pet them.

Adult[edit]

The adult moth is covered in long fur in colors ranging from dull orange to lemon yellow, with hairy legs and fuzzy black feet.

Habitat[edit]

A megalopyge opercularis caterpillar on Kent Island, Maryland, in September 2014. This is a very toxic caterpillar that you should never touch.

M. opercularis can be found on oaks, elms, citrus and other trees, and many garden plants such as roses and ivy. It is distributed throughout the southern United States, Mexico, and parts of Central America. The larva does not spin a real cocoon; rather, it separates from its furry skin and uses it as a protective covering while it pupates.

Dangers and treatment of stings[edit]

Exposure to the caterpillar's fur-like spines will lead to an immediate skin irritation. The caterpillar is regarded as a dangerous insect because of its venomous spines. Medical advice may be sought in case of contact with one. It is best if the venom from the spines is treated within hours of first contact. For first aid, it is recommended that the spines (if present) be removed by using cellophane tape.[2]

Other remedies, which are reported to have varying degrees of success, include ice packs, oral antihistamine, baking soda, hydrocortisone cream, juice from the stems of comfrey plants, or calamine lotion.[2]

References[edit]

  1. ^ Wagner, DL (2005), Caterpillars of Eastern North America., Princeton Univ. Press 
  2. ^ a b c Eagleman, DM (2007). "A Study of the Geographical Distribution and Symptoms of Envenomation by the Asp Caterpillar, Megalopyge opercularis". Clinical Toxicology 46 (3): 201–5. doi:10.1080/15563650701227729. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!