Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) According to Williams et al. (21012) B.(B.) cryptarum is the most widespread species of the subgenus and extends across much of Europe into Central Asia, north China, the Kuril Islands, the east coast of Russia, and north-western North America. In North America this species occurs in Alaska and western Canada southeast to about Banff.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.0 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus cryptarum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Bombus cryptarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 80
Specimens with Barcodes: 171
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Bombus cryptarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 90 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAGGATTTGGAAATTATTTAATTCCATTAATA---TTAGGATCTCCAGATATAGCTTTCCCTCGAATAAATAATATTAGATTTTGACTTTTACCTCCATCATTATTTATACTTTTACTAAGAAATATATTTACACCTAATGTAGGAACAGGATGAACTGTATATCCTCCTTTATCTTCTTATTTATTTCACTCATCACCATCAATTGATATT---GCAATTTTTTCTTTACATATATCAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTTACTATTTTAATAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCCTTACCAGTATTAGCAGGA---GCAATTACAATATTACTTTTTGATCGAAATTTTAATACTTCATTTTTTGATCCTATAGGAGGGGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTCGGTCACCCAGAAGTATATATTTTAATTTTACCAGGATTCGGACTAATTTCACAAATTATTATAAATGAAAGAGGTAAAAAA---GAAACCTTTGGAAATTTAAGAATAATTTATGCTATATTAGGAATTGGATTCTTAGGGTTTATTGTTTGAGCTCATCATATATTTACTGTAGGATTAGATGTAGATACACGAGCATATTTTACATCTGCTACAATAATTATTGCTGTACCTACAGGAATTAAAGTTTTTAGTTGATTA---GCTACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This is one of the most widespread bumblebees in the world. It is common in much of its range, including the North American portion. It is not known to be declining seriously in places where habitats remain. North American populations should be monitored considering the severity of declines of other species in the same subgenus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Koch (2011) did find a strain of Nosema in this species (as B. moderatus) in Alaska. This may well be a long-term native parasite in that area. This situation should be monitored, but for now there does not appear to be cause for concern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bombus cryptarum

Bombus cryptarum is a species of bumblebee. It has been recently discovered in Ireland .[1][2]

References[edit]

  1. ^ http://www.npws.ie/en/media/NPWS/Publications/Redlists/Media,4860,en.pdf
  2. ^ T. E. Murray, Ú. Fitzpatrick, M. J. F. Brown & R. J. Paxton (2008). "Cryptic diversity in a widespread bumble bee complex revealed using mitochondrial DNA RFLPs". Conservation Genetics 9: 653–666. doi:10.1007/s10592-007-9394-z. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Subgenus: Bombus

The taxonomy of this subgenus has long been unstable. It had been particularly unclear whether any North American populations really belonged in the species B. lucorum. Williams et al. (2012), based on multicontinental genetic studies of this subgenus, concluded that much of what had been called B. lucorum, including all North American populations, is actually conspecific with Bombus (Bombus) cryptarum, which ranges across much of Europe and Asia into western North America. All North American records for B. lucorum or B. moderatus are transferred to this species. B. moderatus becomes a synonym of B. cryptarum.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!