Ecology
Associations
In Great Britain and/or Ireland:
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus cryptarum
Animal / sequestrates
female of Psithyrus bohemicus takes over nest of Bombus cryptarum
© BioImages
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Bombus cryptarum
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 90 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 90 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GGAGGATTTGGAAATTATTTAATTCCATTAATA---TTAGGATCTCCAGATATAGCTTTCCCTCGAATAAATAATATTAGATTTTGACTTTTACCTCCATCATTATTTATACTTTTACTAAGAAATATATTTACACCTAATGTAGGAACAGGATGAACTGTATATCCTCCTTTATCTTCTTATTTATTTCACTCATCACCATCAATTGATATT---GCAATTTTTTCTTTACATATATCAGGAATTTCTTCTATTATTGGATCATTAAATTTTATTGTTACTATTTTAATAATAAAAAATTTTTCATTAAATTATGATCAAATTAATTTATTTTCATGATCAGTATGTATTACTGTAATTTTATTAATTTTATCCTTACCAGTATTAGCAGGA---GCAATTACAATATTACTTTTTGATCGAAATTTTAATACTTCATTTTTTGATCCTATAGGAGGGGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTCGGTCACCCAGAAGTATATATTTTAATTTTACCAGGATTCGGACTAATTTCACAAATTATTATAAATGAAAGAGGTAAAAAA---GAAACCTTTGGAAATTTAAGAATAATTTATGCTATATTAGGAATTGGATTCTTAGGGTTTATTGTTTGAGCTCATCATATATTTACTGTAGGATTAGATGTAGATACACGAGCATATTTTACATCTGCTACAATAATTATTGCTGTACCTACAGGAATTAAAGTTTTTAGTTGATTA---GCTACA
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Bombus cryptarum
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 80
Specimens with Barcodes: 166
Species With Barcodes: 1
Public Records: 80
Specimens with Barcodes: 166
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Bombus cryptarum
Bombus cryptarum is a species of bumblebee. It has been recently discovered in Ireland .[1][2]
References
- ^ http://www.npws.ie/en/media/NPWS/Publications/Redlists/Media,4860,en.pdf
- ^ T. E. Murray, Ú. Fitzpatrick, M. J. F. Brown & R. J. Paxton (2008). "Cryptic diversity in a widespread bumble bee complex revealed using mitochondrial DNA RFLPs". Conservation Genetics 9: 653–666.
| This bumblebee-related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
