Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:1,805Public Records:1,282
Specimens with Sequences:1,670Public Species:111
Specimens with Barcodes:1,609Public BINs:117
Species:138         
Species With Barcodes:124         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen39

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Miii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 114
Specimens with Barcodes: 190
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 44
Specimens with Barcodes: 75
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 141
Specimens with Barcodes: 152
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 84
Specimens with Barcodes: 91
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield50

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield39

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ11

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATAGTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCACGGAGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGAGTATCTTCAATTATAGGGGCAATTAATTTTATTACAACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGGTCAGTATTAATTACAGCTTTATTATTATTATTATCATTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ08

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATGTTGGGATTTTCAATAAGTTTAATTATTCGATTGGAATTAGGAACTCCAAGTATATTAATCGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTGATATTAGGAGCTCCTGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAGTTTTAAGAAGATTTATTAATATTGGGGTTGGAACAGGATGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGAGTTTCTTCAATTATGGGAGCAGTTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCCTCAGGTGGAGGAGATCCAATTTTATATCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster amazo4DHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGGTTTGGTAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCACGATTAAATAATATGAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGTTTTATTAATGTTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGGGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACGAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster amazo4DHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield17

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGTTTATGATCTGGAATAGTTGGATTTTCAATAAGATTAATTATTCGTTTAGAGTTGGGTTGCCCCAGTAGATTAATTGGTAATGATCAAATTTATAACAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCACGATTGAATAATATAAGTTTTTGATTATTAATTCCCTCCATTTTTTTATTAATTTTAAGAAGATTTATTAATGTTGGTGTTGGTACTGGATGAACTGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCTGGTAGATCATCTATTATAGGGGCTGTAAATTTTATTACTACTATTTTTAATATACGAGTTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTGTTGTTATTATCATTACCTGTTTTGGCTGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGTTTTTTTGATCCTTCAGGAGGAGGAGATCCAGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield16

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAGTTAGGAACTCCAAATATATTTATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCCCCATTATCATTAATTTTAGGTCATGGAGGTATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Miii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 148 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTCTTATTTGGAATATGATCGGGAATAGTAGGTTTTTCAATGAGAATAATTATTCGATTAGAATTAGGATCTCCTGGTAAATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCTCATGCATTTATTATAATTTTTTTTATAGTGATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGGGCACCAGATATATCTTTCCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTTTTAATAATTTTAAGAAGATTTATTAATGTAGGTGTTGGGACTGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTTGATATTGGAATTTTTTCTTTACATTTAGCTGGGGTTTCTTCTATTATAGGAGCTGTTAATTTTATTACTACAATTTTTAATATACGAATTAATGTATTTAAAATAGATAAAATATCTTTATTTTCATGATCAGTTTTAATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACAATATTATTAACTGATCGTAATTTAAATACAAGTTTTTTTGATCCTTCAGGAGGAGGAGATCCAATTTTATATCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield11

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGAATAATTATTCGATTAGAATTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGNTTAATTCCTTTAATATTAGGGGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGACATGGGGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGTGTATCNTCTATTATGGGGGCAATTAATTTTATTACNACAATTTTTAATATACGAATNAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTAATTACGGCCTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGGGGAGATCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield09

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTGGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACCCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCGCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAGTAATGATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGGTTTATTAATATCGGAGTTGGGACTGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGAGGGATGTCTGTAGATATTGGAATTTTTTCATTGCATTTAGCGGGAGTATCTTCAATTATAGGGGCTATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACGGCTTTATTATTATTATTGTCATTACCTGTTTTGGCAGGTGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield13

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGAAATGATCAGATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGTGGATTTGGGAATTGATTAATTCCTTTAATATTAGGAGCACCGGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTGATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTGGCAGGTGTGTCTTCTATTATAGGGGCAATTAATTTTATTACTACTATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield07

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACGTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATGTCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATATTGGAGTTGGAACAGGGTGAACAGTTTATCCACCATTATCATTAATTTTAGGACATGGAGGAATATCTGTAGATATTGGAATTTTTTCATTGCATTTAGCAGGTGTATCTTCTATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATGGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen18

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield59

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGTATATTAGGATTTTCAATAAGATTAATTATTCGGTTAGAATTAGGAACACCAAAAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTATTAGAAGATTTATTAATATTGGAGTTGGAACTGGGTGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGTGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGTGTATCATCAATTATAGGTGCAATTAATTTTATTACAACAATTTTAAATATACGGATTAATTTATTTAAAATAGATAAAATATCATTGTTTTCTTGGTCAGTTTTTATTACAGCTTTATTATTGTTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCTGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield59

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield58

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTTATATTTCTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGTATATTAATTGGGAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCGCGATTGAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATATTAATAAGAAGATTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGTGGAATATCAGTAGATATTGGAATTTTTTCATTACATTTAGCAGGTGTATCATCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGGTTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield58

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield57

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAATAATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTATAAGTAGATTTATTAATGTTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCGGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCGTGATCAGTATTTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield57

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield56

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACTCCTAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGTAATTGATTAGTTCCCTTAATATTGGGAGCTCCAGATATATCATTTCCGCGATTAAATAACATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGCCATAGTGGAGTATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGGGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield56

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield55

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTATGGTCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTGGGGACTCCAGATATATCATTTCCGCGATTGAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTAGGGGTTGGAACTGGATGAACTGTTTATCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCAGTAGATATTGGAATTTTTTCATTACATTTAGCTGGAATTTCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTAATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield55

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield54

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AATTTTATATTTTTTGTTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTGATTATTCGATTAGAATTAGGAACTCCTAGGATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCGGTAATAATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATATCATTCCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTTGGTACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGTGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGAGTATCTTCAATTATAGGGGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCTGGGGGAGGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield54

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Rodriguez01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGATATATTTTATTTTTGGTATTTGATCTGGAGTTATAGGGTTTTCAATGAGGTTAATTATTCGGTTAGAGTTAGGCAGCCCAGGGAGGTTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATCATAATTTTTTTTATGGTGATACCGGTGATAATTGGTGGATTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCACGAATAAATAATATAAGATTTTGGGTATTAATTCCATCATTATTTTTATTAGTTTTAAGTGGATTTATTAATATTGGTATTGGAACTGGGTGAACAGTTTATCCACCATTATCTTTAAATTTAGGCCATAGAGGTATATCAGTTGATATAGGAATTTTTTCTTTACATTTAGCTGGGGTCTCATCAATTATAGGAGCCATTAATTTTATTACCACAATTATTGTAATAAAAACAAATTTATTTAAAATAGATAAATTATCTTTATTTTCTTGATCAGTTTTTATTACAGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGGGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCNGGAGGGGGGGATCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Rodriguez01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield53

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATGTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTAATTATTCGATTGGAATTAGGATCTCCAGGTAAATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCATTAATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTGATAATTTTTAGTAGATTTATTAATATTGGAGTTGGGACTGGGTGGACAGTGTATCCGCCTTTATCATTAATTTTAGGTCATGGTGGAGTATCTGTAGATATAGGTATTTTTTCTTTACATTTAGCGGGAGTTTCATCTATTATAGGGGCAATTAATTTTATTACTACTATTTTAAATATGCGGGTTAATTTATTTAAAATAGATAAAATATCATTATTTTCTTGATCAGTTTTTGTTACAGCCTTATTATTATTATTATCATTACCTGTATTGGCAGGGGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGGGGAGATCCAGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield53

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield47

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGAATATGATCTGGAATATTAGGATTTTCAATGAGATTAATTATTCGGTTGGAATTAGGAACTCCAAATATGTTAATTGGTAATGATCAGATTTACAATAGGATTGTTACTTCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCATTAATAATTGGTGGATTTGGAAATTGATTGATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGATTAAATAATATGAGGTTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATGTTGGAGTTGGAACAGGATGAACAGTTTATCCACCGTTATCTTTAATTTTAGGTCATGGGGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGGGTATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATGGATAAAATATCTTTATTTACTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCTGGAGCAATTACTATACTATTAACTGATCGTAACTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield47

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield46

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAGTGATAATTGGAGGATTTGGGAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGGGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTGGCAGGTATTTCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTATTTGATCAGTATTTATTACAGCTTTGTTGTTATTATTATCATTGCCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGGTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield46

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield39

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACACCAAATATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTGAATAATATGAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTATAAGAAGATTTATTAATATTGGTGTTGGAACTGGATGAACAGTTTATCCACCATTATCTTTGATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATGGCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTGCCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTCTTTGATCCTTCAGGAGGGGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield44

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCGGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGAATATTTATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATATCATTTCCACGATTGAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTATATCCACCATTATCTTTAATTTTAGGTCATGGAGGTATATCTGTTGATATTAGAATTTTTTCTTTACATTTAGCAGGATTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAGTTAATTTATTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield44

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield45

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NTTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACTCCAAATATATTTATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGGTTAATTCCTTTAATATTAGGGGCTCCAGATATATCATTTCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGTACAGGATGAACAGTTTATCCCCCTTTATCTTTAATTCTAGGTCATGGAGGTATATCTGTAGATATTGGAATTTTTTCTTTACATTTGGCAGGGGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGTGANCCTATTTTANATCANCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield45

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield34

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTATTTGATCTGGAATAATTGGATTTTCTATAAGATTAATTATTCGTTTAGAATTAGGATCACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAGGATTTATTAATGTAGGGGTTGGAACAGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGTGGGTTTTCTGTTGATTTGGGAATTTTTTCCTTACATTTAGCAGGGATTTCATCAATTTTAGGTGCTGTAAATTTTATTACTACTATTTTTAATATGCGAACTAATTTATTTGATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTAATTACAGCATTATTATTATTATTATCTTTACCTGTATTGGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGAGGAGACCCTGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield41

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTATATTTGGTTTATGATCAGGAATAATAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGGACACCAAATATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGATTTGGGAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTATTTCCTTCAGTTTTTTTAATAATTTTAAGAAGATTTATTAATACTGGGGTTGGAACTGGGTGAACAGTTTACCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCTGGAGTTTCTTCAATTATAGGGGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATGTCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTCTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield41

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield42

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTTGGTTTATGGTCAGGTATATTAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTAGGAACTCCAAATATATTAATTGGTAATGACCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAGTAATAATTGGAGGGTTTGGAAATTGATTAATTCCATTAATATTAGGATCTCCTGACATATCATTTCCACGTTTAAATAATATAAGATTTTGGTTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATGTGGGAGTAGGAACAGGATGAACAGTTTATCCACCGTTATCTTTAATTTTAGGACATAGTGGTATATCAGTAGATATAGGAATTTTTTCATTACATTTAGCTGGATTATCATCAATTATAGGATCTATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTAAGATAGATAAAATATCTTTATTTTGTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCAGTGTTAGCAGGTGCAATTACTATGTTGTTAACTGATCGTAATTTAAATACTAGATTTTTTGATCCTTCAGGAGGAGGGGATCCAATTTTGTATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield42

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield38

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGTTGTATTTTTTATTTGGATTATGATCAGGAATATTAGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGTACTCCAAGGATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATGATTGGAGGATTTGGGAATTGATTAATTCCTTTAATATTAGGTACTCCTGATATATCTTTTCCACGATTGAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATAATAAGAAGATTTATTAATATTGGTGTAGGAACTGGTTGAACAGTTTATCCACCATTGTCGTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCATTGCATTTAGCAGGTGTGTCATCAATTATAGGGGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATATATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTGTTTATTACAGCTTTATTATTATTGTTGTCATTACCTGTTTTGGCAGGGGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGGTTTTTTGATCCTTCAGGAGGGGGTGATCCTGTTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield49

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCTGGAATATTGGGATTTTCAATAAGTATAATTATTCGATTGGAACTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAGTAATAATTGGAGGATTTGGGAATTGATTAATTCCTTTAATATTAGGGGCTCCAGATATATCATTTCCACGATTAAATAATATAAGGTTTTGATTGTTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATGTTGGAGTTGGTACAGGGTGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTGGATATTGGAATTTTTTCATTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATGCGAAATAATTTATTTAAAATGGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTGTCTTTACCTGTTTTAGCAGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield49

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield43

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGATTATGATCTGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGGATTCCTAATATGTTAATTGGGAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCTCCCTTATCTTTAATTTTAGGTCATGGGGGTATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCGGGAGTATCTTCGATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATGCGGATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTGGCTGGAGCAATTACAATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield43

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield51

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGTTTTATTAATATTGGAGTTGGAACAGGATGGACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATGGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCCTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield51

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield36

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGATTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACNCCAAATATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATGATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGGGCCCCAGATATATCATTTCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCAGTTTTTTTAATAATTTTAAGTAGATTTATTAATGTTGGGGTTGGTACAGGGTGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGAGGTATATCTGTAGATATTGGGATTTTTTCTTTACATTTAGCAGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTGACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGGGGNGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield35

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATAAGAGTAATTATTCGGTTAGAATTAGGATCTCCGAGTATATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAGTTATGATTGGGGGATTTGGAAATTGATTAATTCCATTGATATTAGGTTCCCCAGATATATCTTTCCCTCGGTTGAATAATATGAGATTTTGATTATTGATTCCTTCAATTTTTTTTATAATTTTAAGAATATTTATTAATGTTGGAGTTGGAACTGGATGAACTGTATATCCACCATTATCTTTAACTTTGGGGCATGGTGGAATATCTGTTGATACAGGTATTTTTTCATTGCATTTAGCTGGAATTTCATCTATTTTAGGTGCTGTTAATTTTATTACTACAATTTTAAATATACGAACAAATTTATTCAAAATAGATAAGATATCATTATTTTCTTGATCAGTATTTATTACAGCATTATTATTATTATTGTCATTACCCGTTTTAGCAGGGGCAATTACTATATTATTAACTGATCGAAATTTGAATACTAGATTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield37

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GNNCGGGAATAGTGGGNNTTTCAATAAGTTTAATTATTCGATNANAATTAGGAACCCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCAGTGATAATTGGTGGATTTGGTAATTGATTAATTCCATTAATATTAGGGTCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGGAGATTTATTAATATTGGAGTTGGGACTGGGTGAACTATTTATCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCAGTAGATATTGGAATTTTTTCATTACATTTAGCAGGGGTATCATCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTACAATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTANCTGATCGTAATTTAAATACANGANTTTTTGATCNTTCNGGANGGGGGGATCCTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield50

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTGATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTATTTTTTTAATAATTTTAAGTAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGTGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTGTTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield48

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTANGATCAGGAATATTAGGATTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAATATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGGAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATGATTTTAAGAAGATTTATTAATATTGGAGTTGGAACAGGTTGAACAGTTTATCCACCTTTATCATTAATTTTAGGTCATGGGGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGTTTTTTTGATCCTTCAGGAGGAGGAGANCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield48

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield33

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCATAAGTATGATTATTCGATTAGAATTAGGTACTCCTAGATCATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCTATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGTGTTGGAACTGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGACATGGAGGAATATCAGTAGATATTGGAATTTTTTCATTACATTTAGCAGGAGTATCATCAATTATGGGGGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield30

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACACCAAATATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCGGATATATCATTTCCACGATTAAATAATATAAGATTTTGGTTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGGATTAATTTATTTAAGATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTGTTATCTTTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield31

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTGTTTGGGCTTTGAGCTGGAATAGTAGGATTTTCTATGAGATTAATTATTCGGTTAGAATTAGGAACCCCAATAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCAGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGTTCACCAGATATATCATTTCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCTATTATTTTAATAATTAGAAGAATATTTATTAATGTTGGAGTAGGAACAGGGTGAACAGTTTATCCACCTTTATCATTAACTTTAGGGCATGGAGGTATATCTGTAGATATTGGTATTTTTTCTTTACATTTAGCTGGGGTATCTTCCATTATAGGGGCAATTAATTTTATTACTACAATTTTAAATATACGAACTATGTTATTTAAAATAGATAAATTATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCTTTACCAGTTTTAGCTGGGGCTATTACTATACTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGAGGGGATCCAGTTTTGTATCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield32

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTATTTGATCTGGAATAATTGGATTTTCTATAAGATTAATTATTCGTTTAGAATTAGGATCACCTGGAATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAGGATTTATTAATGTAGGGGTTGGAACAGGTTGAACTGTTTATCCTCCCTTATCATTAATTTTAGGTCATGGTGGATTTTCTGTAGATTTAGGAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTGTAAATTTTATTACTACAATTTTTAATATACGAACTAATTTATTTTATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTAATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCTGGTGCTATTACAATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTGTATTATATCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield21

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAATTAGGAACTCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATGTTAGGGGCCCCTGATATATCATTTCCACGATTGAATAATATAAGGTTTTGATTATTAATTCCTTCACTTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGGGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCGGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGGTCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield22

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTGGAGTTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGGTTTGGAAATTGATTAATTCCTTTGATATTAGGAGCTCCTGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTAGGAGTTGGAACTGGATGAACAGTATATCCACCTTTATCATTAATTTTAGGTCATGGAGGTATATCAGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTTTATCTTCAATTATAGGGGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGGTCAGTTTTTATCACAGCTTTATTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield26

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGAAATGATCAGATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCGGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATATTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAGTTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTGGCAGGTGTATCTTCTATTATAGGTGCAATTAATTTTATTACAACTATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGANTTTTTGATCCTTCAGNAGGTGGAGANCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ09

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTTTATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGTTTAATTATTCGATTGGAATTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGAATTGTGACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGAGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCATTTCCACGATTAAATAATATAAGGTTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGTTTTATTAATATTGGGGTAGGAACAGGATGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGTATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGGATTTCATCAATTATAGGAGCAGTTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTTTTTATTACGGCTTTATTATTATTATTATCATTACCTGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield28

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGTAATGATCAGATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATGTTAGGGGCACCAGATATATCATTTCCGCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATGTTGGAGTTGGAACAGGATGAACAGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTGGCAGGTGTATCTTCTATTATAGGGGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATGGATAAAATATCTTTATTTTCTTGATCAGTTTTAATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield19

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTCTACTTTATTTTTGGAATATGGTGTGGAATGGTGGGATTTTCAATAAGTATAATTATTCGTTTAGAATTAGGGTGTTCTGGAAGTTTAATTGGTAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGAGGATTTGGAAATTGGTTAATTCCTTTAATATTAGGATCTCCTGATATATCATTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTATTTTATAATTATAAGAAGTTTTATTAATGTTGGGGTTGGTACTGGATGAACTGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGAGGTTTATCTGTTGATATGGGAATTTTTTCACTACATTTAGCAGGTGTATCATCAATTATAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCATTGTTTTCTTGATCAGTGTTTATTACAGCTTTTTTATTATTATTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield20

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGGTCAGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTGAATAATATAAGGTTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATAGAGGAATATCTGTAGATCTTGGAATTTTTTCCCTTCATTTGGCAGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTGTTTATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTGTTTGGAATATGATCAGGAATATTAGGGTTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACTCCAAGTAATTTAATTGGTAATGATCAAATTTATAATAGAATTGTTACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCTTTCCCTCGTTTGAATAATATAAGATTTTGATTACTAATTCCATCTATTTTTTTAATAATTTTAAGAGGATTTATTAATGTTGGTGTTGGTACAGGTTGAACAGTTTATCCTCCTTTATCTTTATTATTGGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCGGGAGTATCATCAATTATAGGTGCAATTAATTTTATTACAACAATTTTAAATATACGAGTTAATTTATTTAAGGTTGATAAAATATCATTGTTTGTATGATCAGTATTTATTACTGCTGTATTATTATTATTATCATTACCAGTATTAGCTGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGGGGGGGAGANCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield25

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGTTTAGAATTAGGTACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGTGGATTTGGAAATTGATTAATTCCCTTAATATTAGGAGCACCAGATATATCATTTCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTTATTAATATTGGAGTTGGGACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTGAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATATGATCAGGAATATTAGGCTTTTCAATAAGGATAATTATTCGATTAGAATTAGGAATTCCTAATATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATATCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTCATTAATGTTGGAGTAGGTACAGGTTGGACAGTTTATCCTCCTTTATCTTTATTATTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAACATACGAGTTAATTTATTTAAGATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGGGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGTGATCCAATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield23

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGGTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACACCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTTATAATTGGGGGTTTTGGGAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGGGTTGGTACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGGGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCTGGAGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAGTTAATTTATTCAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTGGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGGGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ07

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTGTTTGGTTTATGATCTGGAATATTAGGTTTTTCAATAAGATTAATTATTCGATTAGAATTAGGAACACCAAATATATTGATTGGTAATGATCAAATTTATAATAGAATTGTTACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGATCACCAGATATATCATTTCCACGTTTAAATAATATGAGATTTTGATTATTGATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTTGGAACAGGGTGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGGGTGTCATCAATTATAGGGGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATGTCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGGGCAATTACTATATTATTAACGGATCGAAATTTAAATACAAGATTTTTTGATCCTTCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ13

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTGTATTTTTTATTTGGTTTATGGTCAGGAATATTAGGGTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGGTTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATATTGGGGTAGGAACAGGATGAACAGTTTATCCTCCATTATCATTAATTTTAGGTCATGGAGGGATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCTGGTGTTTCTTCAATTATAGGGGCAATTAATTTTATTACTACGATTTTTAATATACGAGTTAATTTATTTAAAATAGATAAAATGTCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGAGGGGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield24

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAGTTAGGAACTCCAAGAATACTTATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGATTCATTAATATTGGAGTTGGAACAGGATGAACGGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGGATATCAGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCTATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster amazo4DHJ02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGAAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAGTAATAATTGGGGGATTTGGAAATTGATTAATTCCTTTAATATTAGGGGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTGAGAAATTTTATTAATGTTGGAGTTGGAACAGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGTATATCTGTTGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATGTCTTTATTTTCTTGATCAGTTTTTATTACAGCTTTATTATTATTATTATCATTGCCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGAGGAGATCCAATTTTATATCAGCATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster amazo4DHJ02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ12

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTGTATTTTTTATTTGGTTTATGATCAGGGATATTGGGATTTTCTATAAGATTAATTATTCGATTAGAATTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGGGTTGGTACAGGGTGAACAGTTTATCCACCATTATCTTTAATTTTAGGACATGGAGGTATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATGGGAGCAATTAATTTTATTACAACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTATTTACTTGATCGGTATTTATTACAGCTTTATTATTATTATTGTCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATATGATCAGGAATATTAGGGTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAATTCCTAGAATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTGATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTAGGTACGGGTTGAACAGTTTATCCTCCTTTATCTTTATTATTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACGACAATTTTAAATATACGAGTTAATTTATTTAAAATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGAGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ06

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 89 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGAATATGATCAGGAATATTAGGCTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAATTCCTAGAATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTGATTCCTTTAATGTTAGGATCCCCTGATATATCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTAGGTACAGGTTGAACAGTTTATCCCCCTTTATCTTTATTATTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTAAAATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGGGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGGGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ10

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCGGGAATATTAGGATTTTCTATAAGTTTAATTATTCGATTAGAATTAGGAACTCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGTAACTGATTAATTCCTCTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGTACTGGGTGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCAGGGGTATCTTCAATTATAGGGGCAATTAATTTCATTACAACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTGTTAATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 76 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTTTATTTGGTATATGATCAGGAATATTAGGTTTTTCAATAAGGATAATTATTCGATTAGAATTAGGAATTCCTAGAATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATATTAGGATCTCCTGATATATCTTTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTAGGTACAGGTTGGACAGTTTATCCACCTTTATCTTTATTATTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTAAAATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGGGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 73
Specimens with Barcodes: 77
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster OVRGDHJ05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTTTATTTGGAATATGATCAGGAATATTAGGTTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAATTCCTAGAATATTAATTGGAAATGATCAAATCTATAATAGAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTTGGAGTAGGTACGGGTTGAACAGTTTATCCACCTTTATCTTTATTATTAGGTCATAGAGGTATATCTTTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTAAAATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGGGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGGGATCCAATTTTATATCAACATTTATTTN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster OVRGDHJ05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Janzen31

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Janzen23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTGGGATTTTCAATAAGTTTAATTATTCGATTGGAATTAGGTACTCCAAGAATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTGATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGTTCTCCAGATATATCATTTCCACGTTTAAATAATATAAGATTTTGATTATTAATTCCCTCACTTTTTTTAATAATTTTAAGAAGATTTATTAATGTAGGAGTTGGTACAGGATGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATAGAGGAATATCAGTAGATATTGGAATTTTTTCTTTACATTTGGCTGGAATTTCATCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield08

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 141 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAATAAGTATAATTATTCGATTAGAATTAGGAACTCCAAATATATTTATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATATTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATGGAGGAATATCTGTAGATATTGGAATTTTTTCTTTACATTTAGCAGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGAAAAAATATCTTTATTTTCTTGATCAGTTTTTATTACAGCTGTATTATTATTATTATCATTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGGGGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield12

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGTATAATTATTCGATTAGAATTAGGGACTCCAAATATATTAATTGGTAATGATCAAATTTATAATAGTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTAATAATTGGAGGATTTGGAAATTGGTTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCACGATTAAATAATATAAGATTTTGATTATTAATTCCTTCAATTTTTTTAATAATTTTAAGTAGTTTTATTAATGTTGGAGTTGGAACTGGATGAACAGTTTATCCACCATTATCATTAATTTTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTGGCAGGTGTATCTTCTATTATAGGAGCAATTAATTTTATTACTACAATTTTTAATATACGAATTAATTTATTTAAAATAGATAAAATATCTTTATTTACTTGATCAGTTCTTATTACGGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGAATATGATCAGGAATATTAGGGTTTTCAATAAGTATAATTATTCGATTAGAATTAGGAATTCCTAGAATATTAATTGGAAATGATCAAATTTATAATAGAATTGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTGTAATGATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGTTTAAATAATATAAGATTTTGATTATTAATTCCATCAATTTTTTTAATAATTTTAAGAAGATTTATTAATGTAGGAGTAGGAACGGGTTGAACAGTTTATCCACCTTTATCTTTATTACTAGGTCATAGAGGTATATCTGTAGATATTGGAATTTTTTCATTACATTTAGCTGGTGTATCTTCAATTATAGGAGCAATTAATTTTATTACTACAATTTTAAATATACGAGTTAATTTATTTAAAATTGATAAAATATCATTATTTTCATGATCAGTTTTTATTACTGCATTATTATTATTATTATCATTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGATCGTAATTTAAATACAAGATTTTTTGATCCATCTGGAGGGGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypomicrogaster Whitfield02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Hypomicrogaster Whitfield04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 64 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTTTATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGAATAATTATTCGTTTAGAGTTAGGAACTCCAAGTATATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCAGATATATCATTTCCTCGATTAAATAATATAAGATTTTGATTATTAATTCCTTCACTTTTTTTAATAATTTTAAGAAGATTTATTAATATTGGAGTTGGGACAGGATGAACAGTATATCCTCCATTATCTTTAATTTTAGGACATGGGGGTATGTCTGTAGATATTGGAATTTTTTCCTTACATTTAGCTGGTGTATCTTCTATTATAGGGGCTATTAATTTTATTACTACAATTTTAAATATACGAATTAATTTTTTTAAAATAGATAAAATATCTTTGTTTACTTGATCAGTATTTATTACAGCTTTATTATTATTATTATCATTACCTGTATTAGCAGGGGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGAGGTGGTGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Hypomicrogaster

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!