Molecular Biology and Genetics

Molecular Biology

Barcode data: Cotesia glomerata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAAT---GATCAGATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGCGGTTTTGGGAATTGATTAATTCCTTTGATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTGATTCCTTCTTTAATATTATTAATTATAAGAAGATTTATTAATGTAGGAGTTGGAACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGGGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATATAAATACAAGATTTTTTGATCCATCAGGTGGAGGGGATCCAATTCTTTATCAACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia glomerata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cotesia glomerata

Cotesia glomerata, the White Butterfly Parasite, is a small parasitic wasp species belonging to family Braconidae.

Description[edit]

Cocoons of Cotesia glomerata with the remains of a dead parasitized caterpillar

The adults of Cotesia glomerata can reach a length of 3–7 millimetres (0.12–0.28 in). This small braconid wasp is black, with two pairs of wings. It can parasitize a wide range of Pieris butterfly species as host, but Pieris brassicae and Pieris rapae are the main hosts. The adults feed on nectar.[2]

Life cycle[edit]

After hatching from the pupae, the females mate and start laying eggs. They eggs are laid in larvae of caterpillars, where the C. glomerata larvae develop. After 15 to 20 days the larvae emerge and the caterpillar dies. The larvae are placed in a heap of yellow silken cocoons attached to the host plant. After 15–20 days the larvae spin their cocoons from which a new generation emerges.[3]

C. glomerata is in turn parasitized by the hyperparasite wasp Lysibia nana.

Distribution[edit]

This species is present in most of Europe, in the Afrotropic ecozone, the Australasian ecozone, the Nearctic ecozone and the Neotropical ecozone.[4]

References[edit]

  1. ^ Biolib
  2. ^ Laing, J.E.; Levin, D.B. (1982). "A review of the biology and a bibliography of Apanteles glomeratus (L.) (Hymenoptera: Braconidae)". Biocontrol News and Information 3 (1): 7–23. ISSN 0143-1404. 
  3. ^ A. Shelton A Guide to Natural Enemies in North America
  4. ^ Fauna Europaea

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!