Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:3335
Specimens with Sequences:2844
Specimens with Barcodes:2396
Species:299
Species With Barcodes:264
Public Records:2172
Public Species:232
Public BINs:235
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia sp. Sff4

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia sp. Sff1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia sp. Sff2

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia sp. Sff2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia JFT09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia cf. specularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia cf. numen

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Janzen02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft88

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft78

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft85

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft73

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft84

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft91

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft59

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft58

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft68

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft94

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft62

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft55

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft93

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft95

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft92

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft67

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft77

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft61

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft74

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft56

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft82

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft63

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft65

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft79

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft75

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft64

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft90

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft89

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft81

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft69

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft87

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft60

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft83

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft86

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft76

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia sp4

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia sp6

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia MS02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield29

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGATTAGAATTAGGTATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGGAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGGGTTGGTACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Janzen01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield09

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCGGGAATATTAGGATTTTCAATGAGTTTATTAATTCGTTTAGAATTAGGAATGCCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATGAGTTTTTGGTTATTAATTCCTTCTTTATTTTTGTTAATTTTAAGAAGATTTATTAATGTTGGTGTTGGTACTGGTTGAACAGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTACTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTGTTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield18

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTGGGATTTTCGATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATGTTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTGTTAATTATAAGGAGTATTATTAATGTGGGTATTGGTACTGGTTGAACTGTTTATCCACCTTTATCATTGATTTTAGGTCATGGAGGAATATCCCTTGATTTAGGAATTTTTTCTTTGCATTTGGCTGGTGCATCTTCAATTATGGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield18

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield41

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATATTAGGATTTTCAATAAGTTTAATTATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTTGTAATGATCAAATTTATAATAGTATAGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTGATATTAGGTTCTCCTGATATATCATTTCCTCGAATAAATAATATGAGTTTTTGGTTATTAATTCCTTCATTAATAATATTATTAATAAGAGGTTTTATTAATATTGGTGTTGGTACAGGTTGAACAGTTTATCCTCCTTTATCTTTAGTTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACAACAATTTTAAATATACGTACAAATTTATTTAAAATAGATAAAATATCATTATTTTCTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield41

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATTTTATATTTTATTTTTGGTTTATGATCAGGTATATTAGGATTTTCAATAAGATTAATAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGTTTTGGGAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGATGAACTGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGGGCATCATCAATTATAGGTGCTATTAATTTTATTACTACAATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCTATTACAATATTATTAACAGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield23

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGCATACCAGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATGATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTGTTATTAATTTTAAGAAGATTTATTAATGTAGGTGTTGGAACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGTATATCTGTTGATTTAGGTATTTTTTCTTTACATTTAGCTGGAGCATCATCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield23

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTGATTATAAGAATATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACAATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTGACTGANCGTAATATAAATACNAGATTTTTTGNTCCTTCAGGTGGNGGTGNTCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield20

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 40 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGATCAGGAATGTTAGGATTTTCAATGAGGATATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTGATATTAGGATCTCCTGATATATCTTTTCCGCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACAGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield31

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATGAGATTATTGATTCGTTTAGAATTAGGAATACCAGGAAGAATAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGAGTTGGTACTGGTTGAACTGTATATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATGTCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield17

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGGTTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAGATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGTAATTGACTAATTCCTTTAATATTAGGGTCTCCTGATATATCTTTTCCTCGAATGAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTAATATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGAACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGTGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTGTTATTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGCGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield30

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGGTTATTAATTCGTTTAGAATTAGGAATACCGGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATGTGGGAGTTGGTACTGGTTGAACTGTGTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCGGTTGATTTGGGAATTTTTTCTTTACATTTAGCTGGAGCGTCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTTTAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTACTATTATTATCTTTACCTGTTTTAGCCGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield15

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTTCTATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGGATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTAATATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTATATCCTCCTTTATCATTAATTTTAGGTCATGGAGGGATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGTGCATCATCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGGTCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATTNT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield32

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGTTTTTCAATAAGATTATTAATTCGTTTAGAATTAGGTATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTAATATTATTAATTTTAAGAAGATTAATTAATACAGGAGTTGGTACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGTATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTGTTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield16

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATGAGGTTATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGGATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTAATATTAATTTTAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGTGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATTTAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTGTTGTTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATGAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield35

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGGGTTGGAACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATGTCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGAGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGGTTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield40

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTAATATTATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGAACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGTATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCATTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield26

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTAATATTATTAATTTTAAGAAGATTTATTAATGTAGGGGTAGGAACTGGTTGAACTGTATATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield36

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTGATTCGTTTAGAATTAGGTATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTGATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGAGTAGGTACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield24

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGGATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGTACTGGTTGAACTGTATATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTTATATAGATAAAATATCTTTATTTTCTTGGTCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGGGATCNNATTCNTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield06

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGGAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTGTTATTGATTATAAGAAGATTTATTAATGTGGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAGTTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACAGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGANNGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield13

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGGTTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTAATTATAAGAATATTTATTAATGTAGGTGTAGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGGGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCTTCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATAAATATACGATCAAATTTATTTAATATAGATAAAATATCTTTATTTTCATGATCTGTATTTATTACTGCAATTTTATTATTATTGTCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield11

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 59 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTAGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTAATTATGAGAAGATTTATTAATGTTGGTGTTGGTACTGGTTGAACTGTTTATCCTCCATTATCATTAATTTTAGGTCATGGGGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCTTCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATTAATATACGATCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 49
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield34

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGACTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGAGTTGGAACTGGTTGAACTGTTTATCCCCCTTTATCTTTAATTTTAGGTCATGGTGGGATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCGATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCNGNNTNAGCTGGTGNNNNNACTATATTANTAACTGATCGTAATATAAATACGAGATTTTTTGATCCTTCAGGTGGTGGTGATCCNATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGGTTTGGAAATTGGTTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGTTTTATTAATGTGGGGGTTGGTACTGGTTGAACTGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCAGGGGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATTAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield08

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGAAATGATCAAATTTACAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTCTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTGTTAATTATAAGAAGSTTTATTAATGTAGGTGTTGGAACTGGATGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATGAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAGTTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACCTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATTAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield10

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTGTATTTTATTTTTGGTTTTTGATCAGGAATATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTTTATTAATTATTAGAAGATTAATTAATGTGGGTGTTGGAACTGGTTGAACTGTATATCCTCCTTTATCATTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGATCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTGTTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield07

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCGGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATGATTTTTTTTATGGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATGTCTTTTCCTCGAATGAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTGTTAATTATAAGAAGATTTATTAATGTGGGTGTTGGTACAGGTTGAACTGTCTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGTATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGNGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGNGGNGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAGTTAGGAATACCNGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACCTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTATTTATCCACCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATTAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield37

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTGGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATGGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGAACTGGTTGAACTGTATATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCTTCATCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAAATTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGAGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield27

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNTTTTCAATAAGATTATTAATTCGTTTAGAATTGGGAATATCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTAATTTTATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGTACTGGTTGAACTGTTTATCCACCTTTATCTTTAATTTTAGGACATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGGTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGGGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield28

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTTTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTYCAGATATATCTTTTCCACGAATAAATAATATAAGGTTTTGATTATTAATTCCTTCTTTATTTATATTAATTTTAAGAAGATTAATTAATGTGGGAGTTGGAACTGGTTGAACTATTTATCCTCCTTTATCTTTAATTTTAGGACATGGGGGGATATCTATTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTTTAAATATACGTTCGAGTTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGNGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield12

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATGTTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTGATTCCTTTAATATTAGGATCTCCTGATATATCCTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTGATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGGGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCTTCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATAAATATACGATCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCGGGTGGAGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield64

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTGGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCATTATTATTATTAATTTTAAGAAGATTTATTAATACAGGGGTTGGAACTGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATGGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGGGATCCTATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield64

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield65

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTAATATTATTAATTTTAAGAATATTTATTAATGTTGGAGTTGGTACTGGTTGAACTGTATACCCACCTTTATCTTTAATTTTAGGTCATGGAGGGATATCAGTTGATTTAGGAATTTTTTCTTTGCATTTGGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield65

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield52

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCGGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGGTTAATTCCTTTAATATTGGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTAATATTATTAATTTTAAGTATATTTATTAATGTAGGAGTTGGTACAGGTTGAACTGTATATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGAAATATAAATACAAGATTTTTTGATCCTTCAGGTGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield52

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield69

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATACTATATTTTATATTTGGATTATGATCAGGGATATTGGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGTATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCACCAGATATGTCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTAATATTATTAATTTTAAGAATATTTATTAATGTAGGAGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCGTCTTCAATTATAGGTGCTGTAAATTTTATTACAACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCATGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGGGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield69

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield70

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGGTCAGGAATATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTGGGAATACCAGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACATCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGGATAAATAATATAAGTTTTTGACTTTTAATTCCTTCTTTATTATTATTAGTTTTAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTGGGAATTTTTTCTTTACATTTGGCTGGGGCATCTTCAATTATGGGTGCAATTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield70

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield88

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

NNNNNNTNTTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCTATAAGATTAATTATTCGTTTAGAACNTGGTNTACCAGGAAGTTTAATTGGTAATGATCAAATTTATAATAGGATTGTGACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATACTAGGATCCCCAGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTGTTATTAATTATAAGAAATTTTATTAATACTGGGGTTGGAACTGGATGAACAGTATATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATTTAGGTATTTTTTCTTTACATTTAGCTGGAGCTTCTTCAATTATAGGAGCTGTAAATTTTATTACAACTATTTTAAATATACGAACAAATTTATTTAATATGGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCATTACCAGTATTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCATCTGGTGGTGGTGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield88

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield82

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTTTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCACGAATAAATAATATAAGGTTTTGGTTATTAATTCCTTCTTTATTAATATTAATTTTAAGAAGATTTATTAATATTGGTGTTGGTACTGGTTGAACAGTTTATCCACCATTATCATTAATTTTAGGCCATGGTGGGATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCCGGTGCTTCTTCTATTATAGGTGCTGTTAATTTTATTACTACAGTTTTGAATATACGTTCAAATTTTTTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTGTTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCTTCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield82

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield73

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGTTTATGATCAGGGATATTAGGATTTTCAATGAGTTTAATAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTAGTAATGATCAGATTTATAATAGAATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGGTCTCCAGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTAATAATATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGTACAGGTTGAACTGTATATCCTCCTTTATCTTTAATTTTAGGCCATGGTGGAATATCAATTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGTTCAAGTTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCTGTGTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGAGGGGGGGATCCAATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield73

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield77

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATGAGGATATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGGAATTGATTAATTCCTTTGATATTAGGATCTCCTGATATATCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTTTAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTAGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield77

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield78

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATGTTAGGATTTTCAATGAGAATATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTGATATTAGGATCTCCTGATATATCTTTTCCGCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACAGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield78

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield79

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATGTTAGGATTTTCAATGAGGATATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTGATATTAGGATCTCCTGATATATCTTTTCCGCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACAGGTTGAACTGTTTACCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTGCCCGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCNATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield79

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield80

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTGGGATTTTCGATAAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTGATTCCTTTAATGCTAGGATCTCCTGATATATCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGGAGTATTATTAATGTGGGTATTGGTACTGGTTGAACTGTTTATCCGCCTTTATCATTGATTTTAGGTCATGGGGGAATATCCCTTGATTTAGGAATTTTTTCTTTGCATTTGGCTGGTGCATCTTCAATTATGGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGAGGTGATCCAATTCTTTATCAACATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield80

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield89

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATGAGATTATTAATTCGTTTAGAATTAGGAATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTGATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCTTTATTATTGTTAATTATGAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAAGTATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATAGGTGCTATTAATTTTATTACTACTATTATTAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGGTCTGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGGTTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAGCATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield89

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGTTTATGATCAGGAATGTTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGTATACCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTATTATTAATTATAAGAAGATTTATTAATGTAGGAGTTGGTACTGGTTGAACTGTTTATCCGCCTTTATCATTAACTTTAGGGCATGGTGGAATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCATCTTCAATTATAGGTGCTGTAAACTTTATTACTACTATTATAAATATACGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCTGTTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACGAGATTTTTTGATCCTTCAGGAGGCGGTGATCCAATTCTTTATCAGCATTTATTTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGAATTTGATCTGGAATATTAGGATTTTCATTAAGATTAATTATTCGTTTAGAACTTGGTATACCAGGGAGATTAATTGGTAATGATCAAATTTATAATAGGATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCCCCTGATATATCTTTTCCTCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTAATTTTAAGAGGTTTTATTAATATTGGAGTTGGAACAGGTTGAACAGTCTATCCACCTTTGTCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATTTGGGTATTTTTTCTTTACATTTAGCTGGTGCATCTTCTATTATAGGTGCTGTAAATTTTATTACAACAATTTTAAATATACGATCTAATATATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCATTACCTGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGTAATATAAATACTAGTTTTTTTGATCCATCGGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft37

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft48

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft54

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft44

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft42

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft45

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft50

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft53

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft51

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft41

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft05

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGGATATTAGGATTTTCTATAAGTTTAATTATTCGTTTAGAGCTTGGTATACCTGGGAGTTTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTATTATTAATTATAAGTGGTTTTATTAATACAGGGGTTGGAACTGGTTGAACTGTTTATCCACCTTTATCTTTAATTTTAGGTCATGGTGGTATGTCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGAGCTTCATCAATTATAGGAGCTGTTAATTTTATTACTACTATTTTAAATATACGAACAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCATTACCTGTATTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCATCTGGTGGTGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft06

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 61 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTCGGAATTTGATCTGGAATTTTAGGATTTTCGTTAAGATTAATTATTCGTTTGGAGCTTGGAATACCAGGGAGATTAATTGGTAATGATCAAATTTACAATAGAGTTGTAACTTCACATGCATTTGTTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCACGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCTTTGTTTTTATTAATTTTAAGAGGATTTATTAATACTGGAGTTGGAACAGGTTGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGACATGGTGGTATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACAACTATTTTAAATATACGTTCTAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACAGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCTTCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft09

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 64 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATATTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGATTAGAATTAGGAATGCCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGATTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCACGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTAATATTAATTATGAGTAGATTTATTAATGTTGGTGTTGGTACTGGTTGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCTTCTTCAATTATGGGTGCTGTTAATTTTATTACTACTATTATAAATATACGTTCTAATTTATTTAATATAGATAAAATGTCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACAATGTTATTGACTGATCGTAATATAAATACTAGATTTTTTGATCCTTCAGGAGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 74
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft07

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGGTCAGGTATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAGTTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGTATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTAATATTAATTATAAGAAGATTTATTAATGTTGGAGTTGGAACTGGTTGAACAGTTTATCCACCATTATCTTTAATTTTAGGTCATGGTGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGGGCTTCTTCAATTATAGGTGCTGTTAATTTTATTACTACAATTATAAATATACGTTCTAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCATCAGGAGGAGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft08

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 74 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATACTTTATTTTTGGAATTTGATCAGGAATATTAGGATTTTCATTAAGATTAATTATTCGTTTAGAATTGGGTATACCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAATTATACCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTATTTTTATTAATTTTAAGAGGTTTTATTAATATTGGAGTTGGAACAGGTTGAACAGTTTATCCACCTTTATCTTTAATTTTAGGTCATGGTGGTATATCTGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCTATTATAGGTGCTGTAAATTTTATTACAACAATTTTAAATATACGTTCTAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTAATATCTTTACCTGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCATCAGGTGGTGGTGATCCAATTCTTTATCNGCNTTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft08

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 72
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft04

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTGTATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAACTTGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCACCTGATATATCTTTTCCTCGAATAAATAATATGAGTTTTTGGTTATTAATTCCTTCATTATTAATATTGATTATAAGAAGTTTTATTAATGTGGGTGTTGGAACTGGATGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGTGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGTGCTTCTTCAATTATAGGTGCTGTAAATTTTATTACTACAATTATAAATATACGTTCTAATATATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCGATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACAATATTATTAACTGATCGTAATATAAATACTAGATTTTTTGATCCAGCAGGAGGAGGTGATCCTGTTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft04

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia jft03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGAATAATAGGATTTTCAATAAGATTAATTATTCGTTTAGAATTGGGTATACCAGGAAGTTTAATTGGTAATGATCAAATTTATAATAGGATTGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCATTAATAATTGGTGGATTTGGGAATTGATTAATTCCTTTAATATTAGGTTCACCAGATATATCTTTTCCACGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCATTAATATTATTAGTTTTAAGTATATTTATTAATGTAGGGGTTGGTACTGGATGAACAGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCATTACATTTAGCTGGAGTTTCTTCAATTATAGGTGCTGTAAATTTTATTACTACAATTATAAATATACGTTCAAATTTATTTAATATAGATAAGATATCATTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCATTGCCTGTTTTAGCTGGTGCTATTACTATATTATTGACTGATCGTAATATAAATACTAGATTTTTTGATCCATCAGGTGGTGGTGATCCAATCCTTTATCAGCATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft33

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft46

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft40

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft49

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft39

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield97

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATGAGTTTAATTATTCGTTTAGAATTAGGAATATCAGGTAGATTAATTGGTAATGATCAAATTTATAATAGTATAGTAACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTGTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCATTTCCTCGAATAAATAATATAAGTTTTTGATTATTAATTCCTTCTTTAATAATATTAATAATAAGGGGTTTTATTAATATTGGTGTTGGAACAGGTTGAACAGTTTATCCTCCTTTATCTTTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCTTCTTCAATTATAGGTGCTGTAAATTTTATTACAACAATTTTAAATATACGTACAAATTTATTTAAAATAGATAAAATATCATTATTTTCTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield97

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whifield93

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATATTATATTTTATTTTTGGTTTATGATCAGGAATATTAGGATTTTCAATAAGGTTGTTAATTCGTTTAGAATTAGGTATACCAGGAAGATTAATTGGGAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCAGTAATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCTCGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCATTATTGTTATTAATTATAAGAAGATTTATTAATGTAGGTGTTGGTACTGGTTGAACTGTTTATCCTCCTTTATCATTAGTTTTAGGTCATGGGGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCATCTTCAATTATGGGTGCTATTAATTTTATTACTACAATTATAAATATACGATCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGGGGTGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whifield93

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield95

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATATTATATTTTATATTTGGTTTATGGTCAGGAATATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGAACTTCAGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGAAATTGACTAATTCCTTTAATATTAGGATCTCCAGATATATCTTTTCCTCGGATAAATAATATAAGATTTTGATTATTAATTCCTTCTTTATTTTTATTAATTTTAAGAAGATTTATTAATGTAGGAGTTGGTACTGGTTGAACTGTTTATCCACCTTTATCTTTAATTTTAGGTCATGGTGGAATATCTGTTGATTTAAGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTAAATTTTATTACTACTATTATAAATATACGGTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATGTTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield95

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield96

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGTTTAATTATTCGTCTAGAATTAGGGATACCAGGTAGATTAATTTGTAATGATCAAATTTATAATAGTATAGTTACTTCACATGCATTTATTATAATTTTTTTTATAGTTATACCTTTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTCACCTGATATATCATTTCCTCGAATAAATAATATGAGTTTTTGATTATTAATTCCTTCTTTAATAATATTATTAATAAGGGGTTTTATTAATACGGGTGTTGGGACAGGTTGAACAGTTTATCCACCTTTATCTTTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTTAATTTTATTACAACAATTTTAAATATACGTACAAATTTATTTAAAATAGATAAAATATCATTATTTTCTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield96

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield98

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATATTATATTTTATATTTGGATTATGATCAGGAATATTAGGATTTTCAATAAGTTTAATTATTCGTCTAGAATTAGGAATACCAGGTAGATTAATTTGTAATGATCAAATTTATAATAGTATAGTTACTTCACATGCATTAATTATAATTTTTTTTATAGTTATACCTTTAATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTCACCTGATATATCATTTCCTCGAATAAATAATATGAGTTTTTGATTATTAATTCCTTCTTTAATAATATTATTAATAAGGGGTTTTATTAATACGGGTGTTGGGACAGGTTGAACAGTTTATCCACCTTTATCTTTAATTTTAGGTCATGGAGGTATATCAGTTGATTTAGGAATTTTTTCTTTACATTTAGCTGGTGCATCTTCAATTATAGGTGCTGTTAATTTTATTACAACAATTTTAAATATGCGTACAAATTTATTTAAAATAGATAAAATATCATTATTTTCTTGATCTGTTTTTATTACTGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCAATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCTATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield98

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cotesia Whitfield94

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTAGGATTTTCAATAAGATTATTAATTCGTTTAGAATTAGGTATACCTGGAAGATTAATTGGAAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTGTTATAATTGGTGGTTTTGGTAATTGATTAATTCCTTTAATATTAGGATCTCCTGATATATCTTTTCCACGAATAAATAATATAAGTTTTTGGTTATTAATTCCTTCTTTATTATTATTAATTTTAAGAATATTTATTAATGTAGGTGTTGGAACTGGTTGAACTGTATATCCTCCTTTATCATTAATTTTAGGTCATGGAGGAATATCAGTTGATTTAGGAATTTTTTCTTTACATTTGGCTGGAGCTTCTTCAATTATAGGTGCTGTTAATTTTATTACTACTATTATAAATATGCGTTCAAATTTATTTAATATAGATAAAATATCTTTATTTTCTTGATCAGTATTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGATTTTTTGATCCTTCAGGTGGGGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia Whitfield94

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft22

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft31

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft18

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft27

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft43

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cotesia jft47

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cotesia

Cotesia is a genus of Braconid wasp.

Species [edit]

List of Cotesia species

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!